0

revision of direct and reported speech 1 statements a i say to her i have something to show you

Ôn tập Học kì I

Ôn tập Học kì I

Tiếng anh

... I Revision of Direct and Reported speech Statements: a I say to her : “ I have something to show you I tell her that I have something to show her b I said to her : “ I have something to show ... question) Imperative: a The teacher said: “ go to the blackboard, Lan” The teacher told Lan to go to the blacboard b The teacher said to his student: “Don’t be late tomorrow” The teacher said to his ... show you I told her that I had something to show her S + V + ( object ) + S+ said say( s) that + tell(s) + obj +(that) told Question: a She asked me: “ Do you like him ?” She asked me If I liked...
  • 24
  • 351
  • 0
Tài liệu Design and access statements - How to write, read and use them pdf

Tài liệu Design and access statements - How to write, read and use them pdf

Mỹ thuật

... statement should justify and explain the hard and soft landscaping of private and public spaces It should explain the purpose of landscaping and its relationship to the surrounding area The landscaping ... description and justification of the planning application Sometimes photos, maps and drawings may be needed to further illustrate the points made They will be available alongside the application for anyone ... process of making a planning application encourages everyone to think about how inclusive, practical and attractive a place will be once it is built This guide is divided in three sections: Part 1: ...
  • 34
  • 753
  • 2
Tài liệu Medical Countermeasures Dispensing Emergency Use Authorization and the Postal Model ppt

Tài liệu Medical Countermeasures Dispensing Emergency Use Authorization and the Postal Model ppt

Sức khỏe giới tính

... a national repository of antibiotics, chemical antidotes, antitoxins, life-support medications, IV administration and airway maintenance supplies, and medical/surgical items The SNS is designed ... Acute radiation syndrome Covered Countermeasure Vaccine, antimicrobial/antibiotic diagnostic, etc Date of Declaration 10 /10 /08 Anthrax Vaccine, antimicrobial/antibiotic, diagnostic, etc 10 / 01/ 08 ... public health departments face challenges in connecting with the commercial sector to maintain situational awareness The availability (or lack of availability) of commercial-sector assets is a...
  • 94
  • 1,040
  • 0
Wake 'em Up: How to Use Humor and Other Professional Techniques to Create Alarmingly Good Business Presentations

Wake 'em Up: How to Use Humor and Other Professional Techniques to Create Alarmingly Good Business Presentations

Kỹ năng thuyết trình

... speaker at the All California Regional Conference for Meeting Professionals International and also for their educational retreat in Ottawa, Canada In addition to his busy corporate speaking schedule ... Speaking System This training course is considered the standard for training professional or aspiring professional speakers in the art of speaking and the science of marketing professional speaking ... • Acronyms and Abbreviations Advertisements Alliteration Anachronisms Asides Audience Gags Bloopers Caricature Cartoons and Comic Strips Comic Verse Costumes Definitions Exaggeration Fake Facts...
  • 877
  • 6,533
  • 1
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học

... Identification of positive and negative determinants of malonylCoA sensitivity and carnitine affinity within the amino termini of rat liver- and muscle-type carnitine palmitoyltransferase I J Biol ... G (19 99) A single amino acid change (substitution of glutamate with alanine) in the N-terminal region of rat liver carnitine palmitoyltransferase I abolishes malonyl-CoA inhibition and high affinity ... excessive fatty acid oxidation in diabetes mellitus [26], and in myocardial ischemia, where accumulation of long- D17E as a malonyl-CoA sensitivity determinant of CPT1B Fig Malonyl-CoA sensitivity...
  • 9
  • 550
  • 0
Regional Food Hub Resource Guide: Food hub impacts on regional food systems, and the resources available to support their growth and development pdf

Regional Food Hub Resource Guide: Food hub impacts on regional food systems, and the resources available to support their growth and development pdf

Tiếp thị - Bán hàng

... are having in accessing capital Many of the interview participants identified access to capital as a primary limiting factor to growth The lack of capital access was linked not only to infrastructural ... opportunities to receive customized practical training in an unfamiliar field Agricultural Land Based Training Association (ALBA), in Salinas, CA, supports new farmers through its Farmer Education ... origin, age, disability, and where applicable, sex, marital status, familial status, parental status, religion, sexual orientation, political beliefs, genetic information, reprisal, or because...
  • 92
  • 469
  • 0
báo cáo hóa học:

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

Hóa học - Dầu khí

... assay to measure MCP -1 ligand internalization in clinical trials as a measure of the pharmacodynamic effect of our CCR2 antagonist Unlike pharmacokinetic and immunogenicity assays [10 15], there has ... treatment value It is therefore critical that the variability of the cytometric assay be well understood prior to initiation of a clinical trial Further refinement of the longitudinal variability ... expected that fractional values such as that observed after saturation inhibition to have greater variability Similarly, the interperson variability was also anticipated to be greater and was to be...
  • 12
  • 829
  • 0
Báo cáo y học:

Báo cáo y học: "Factor VII and the brain: time to get this research done" potx

Báo cáo khoa học

... Critical Care Vol 11 No Dutton the extent that hemorrhagic stroke and TBI have similar pathophysiology, early findings with use of FVIIa in stroke patients have also been encouraging [3] ... factor VIIa in haemorrhagic shock and intracerebral bleeding Injury 2006, 37 :11 72 -11 77 Mayer SA, Brun NC, Begtrup K, Broderick J, Davis S, Diringer MN, Skolnick BE, Steiner T; Recombinant Activated ... our therapeutic quiver Competing interests RD has received research funding and consulting fees from Novo Nordisk, Inc, the manufacturers of FVIIa and is a member of their international steering...
  • 2
  • 174
  • 0
Báo cáo y học:

Báo cáo y học: "Metabolic cycle, cell cycle, and the finishing kick to Start" potx

Báo cáo khoa học

... respiration and glycolysis are occurring at a high rate; a high rate of respiration is shown by a high rate of oxygen consumption, whereas a high rate of glycolysis is shown by a respiratory ... sufficiently high for all needs The finishing kick and critical size Another interesting possibility is that the oscillation in NADH (and the opposite-phase oscillation in NAD) could affect the activity ... that oxidative and reductive processes are compartmentalized; this is based in part on an oscillation in NADH [18 ] This oscillation is tricky to interpret, however First, oxidative and reductive...
  • 5
  • 231
  • 0
Báo cáo y học:

Báo cáo y học: "Origin of nascent lineages and the mechanisms used to prime second-strand DNA synthesis in the R1 and R2 retrotransposons of Drosophila" doc

Báo cáo khoa học

... AATATTTGGGTATTTATAATTACAAG M (9) AGAGGACGCACCGTGAACTAA -9 AGAGGATGCACATGAATGGATTAACGACGGACGTGTT -9 AATATTCTGGTATTTATGAATGGATTAACGACGGACGTGTT M (10 )TCCATAAGTCGCTAGAAGAAT -9 TCCATAAGCCGCGCATGAATGGATTAACGACGGACGTGTT ... data file 8); Drosophila ananassae R 1A (Additional data file 9); Drosophila ananassae R1B (Additional data file 10 ); Drosophila erecta R1 (Additional data file 11 ); Drosophila grimshawi R1 .1 ... suggested a reevaluation of this second-strand cleavage location was needed (a) Volume 10 , Issue 5, Article R49 Stage and Eickbush R49.6 3’ junctions AAAAAAAAAATAGCCAAATGCCT 99% AAAAAAAAAAAAGCCAAATGCCT...
  • 17
  • 240
  • 0
the use of and the attitudes toward slang expressing surprise and disbelief among young americans = việc sử dụng và quan điểm đối với tiếng lóng biểu lộ sự ngạc nhiên và hoài nghi của giới trẻ mỹ

the use of and the attitudes toward slang expressing surprise and disbelief among young americans = việc sử dụng và quan điểm đối với tiếng lóng biểu lộ sự ngạc nhiên và hoài nghi của giới trẻ mỹ

Khoa học xã hội

... 1. 1.6 Lexicological and semantic classifications of slang Slang is traditionally categorised in the perspectives of lexicology, semantics, and lexicography Lexicological classification of slang ... and disbelief through slang is one kind of speech act used frequently in interaction 1. 3 American slang and its role in today’s American society 1. 3 .1 American slang and its characteristics It‘s ... characteristics of these participants as juvenile and linguistically adventurous They are at a vital stage in their language development to be trial and creative with language and to assert language as...
  • 64
  • 475
  • 1
The Use of and the Attitudes toward Slang Expressing Surprise and Disbelief among Young Americans

The Use of and the Attitudes toward Slang Expressing Surprise and Disbelief among Young Americans

Tổng hợp

... slang” as a speech act 14 1. 3 American slang and its role in today’s American society 15 1. 3 .1 American slang and its characteristics 15 1. 3.2 Importance and prevalence of slang ... social aspects of language variation 1. 1.5 Social functions of slang 10 1. 1.6 Lexicological and semantic classifications of slang 11 1. 2 Expressing surprise and disbelief ... population selection, data collection and analysis Chapter III: Data Analysis and Results The part deals with the findings drawn out from the analysis of data The findings and discussion are based...
  • 14
  • 495
  • 1
AN1069   using c30 compiler and the SPI module to interface EEPROMs with dsPIC33F and PIC24F

AN1069 using c30 compiler and the SPI module to interface EEPROMs with dsPIC33F and PIC24F

Cao đẳng - Đại học

... NOT LIMITED TO ITS CONDITION, QUALITY, PERFORMANCE, MERCHANTABILITY OR FITNESS FOR PURPOSE Microchip disclaims all liability arising from this information and its use Use of Microchip devices in ... recycled paper Microchip received ISO/TS -16 949:2002 certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design ... ready for additional commands The WEL bit is also cleared at the end of a write cycle, which serves as additional protection against unwanted writes The part remains in a continuous RDSR loop and...
  • 12
  • 315
  • 0
AN1079   using the c30 compiler and the i2c™ peripheral to interface serial EEPROMs with dsPIC33F

AN1079 using the c30 compiler and the i2c™ peripheral to interface serial EEPROMs with dsPIC33F

Cao đẳng - Đại học

... CONDITION, QUALITY, PERFORMANCE, MERCHANTABILITY OR FITNESS FOR PURPOSE Microchip disclaims all liability arising from this information and its use Use of Microchip devices in life support and/ or ... ACTIVITY MASTER Data (n) Data (n + 1) SDA LINE BUS ACTIVITY © 2007 Microchip Technology Inc A C K A C K A C K DS 010 7 9A- page 11 AN1079 SEQUENTIAL READ Just as the page write operation exists to ... but leaves SDA high to transmit a NO ACK bit after the final data byte And as with all other operations, a Stop condition is generated to end the operation SEQUENTIAL READ (LAST TWO DATA BYTES)...
  • 16
  • 373
  • 0
Bài 15 - How to write sentences (Cách viết câu)-phần1 pps

Bài 15 - How to write sentences (Cách viết câu)-phần1 pps

Anh ngữ phổ thông

... What a piece of work is a man! how noble in reason! how infinite in faculty! in form and moving how express and admirable! in action how like an angel! in apprehension how like a god!" (William ... like to see a copy of the report and please send it, today by priority mail c Yes, I would like to see a copy of the report and, please send it today by priority mail d Yes, I would like to see a ... does not have a camping permit, to use this campground a As soon as he finished his homework, Rod, who is a member of the baseball team, went to batting practice b As soon as he finished his homework...
  • 24
  • 317
  • 1
Bài 15 - How to write sentences (Cách viết câu)-phần2 pot

Bài 15 - How to write sentences (Cách viết câu)-phần2 pot

Anh ngữ phổ thông

... provided an explanation of the computer to his grandmother During the time when I lived in South Carolina, it was my intention to go to college in Florida 10 After extensive nightly labors on an ... and feeling He was really late to his English class due to the fact that he had to finish his math test 5 In hopes of rejuvenating their romantic liaison, the couple went on a pilgrimage to become ... explained the computer to his grandmother When I lived in South Carolina, I planned to attend college in Florida 10 After staying up all night finishing a paper, Sally needed a long nap ...
  • 14
  • 370
  • 0
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english  a comparison

Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison

Khoa học xã hội

... (2) IR (1) IERE (9) IA (4) IER (1) AAT (1) IERE (2) IA (5) IER (1) IR (1) IA (2) DN (2) IERE (12 ) IA (1) IER (1) APO (1) DN (3) IERE (1) IR (1) IA (2) NSEs IERE (3) AGA (1) IA (4) IER (2) APO (1) ... IERE (2) IA (1) APO (3) AGA (1) DN (1) IERE (2) IA (1) IERE (1) AGA (1) IA (1) Table 3: Order of semantic formulas in refusals to an equal-status person The table shows that similar to a higher-status ... Laotian and Turkish Thirty participants filled in their refusal DCT in English – 10 Americans, 10 Laotians, and 10 Turkish The data were also analysed in terms of semantic formulas and categorized...
  • 44
  • 1,183
  • 4
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học

... biological assays for inhibitory factors such as MIH have been reported, and the inhibitory function on molting has been demonstrated convincingly Most biological assays of the gonad inhibition of ... sonicated, and agitated overnight at °C Following centrifugation as above, the supernatant was collected and loaded into an Ni2+–nitrilotriacetic acid–agarose (Qiagen, Hilden, Germany) affinity ... expression in hepatopancreas and ovary in vitro, the result may provide information on the initial mechanism of hormone action In other words, the in vitro results indicate that MeMIH-B may act directly...
  • 11
  • 546
  • 0
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx

Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx

Sức khỏe giới tính

... others, to learn to live in a healthy, harmonious way' and to liberate that which is most inspiring and creative within man, then we have to realize the limitations of the materialistic approach ... that, while it is useful for dealing in generalizations, groups, and quantities, it is almost always rather irrelevant in relation to individuals and qualities, which are the primary focal points ... Philosophy at MIT and author of The Religions of Man, states: There are three great civilizations: Western, East Asian (Chinese), and South Asian (Indian) Historically, in their main periods,...
  • 40
  • 539
  • 1

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008