reversible work of an open system in a steady state flow process
Báo cáo y học: "Life-threatening biopsy of an iliopsoas pseudotumour in a patient with haemophilia: a case report" docx
... duodenal hematoma in hemophilia A J Pediatr Surg 1989, 24:406-408 Prasad S, Patankar T, Krishnan A, Pathare A: Spontaneous isolated lesser sac hematoma in a patient with hemophilia Indian J Gastroenterol ... Merchan EC: The haemophilic pseudotumour Int Orthop 1995, 19:255-260 Armas-Loughran B, Kalra R, Carson JL: Evaluation and management of anemia and bleeding disorders in surgical patients Med Clin ... are ordered based on information obtained from the history and physical examination; in our case this was missed and, coupled with the assumed radiological diagnosis of a psoas sarcoma, all of...
- 4
- 293
- 0
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... matter (OM) is the organic fraction of soil, including wastewater pollutants, plant roots, animal and plant residues, and microbial biomass OM influences the chemical and physical properties of ... 2007 Chiang Mai, Thailand ================================================================================ In analysis, data were compared graphically and by an ANOVA analysis at the significant ... Materials and methods Sand sampling was done during January 2007 in the experimental constructed subsurface flow wetland (CSFW) located at Campus I of Can Tho University (Figure 1) The main part of...
- 6
- 473
- 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot
... language question answering system for a large relational database Cowzm A C M 21 (1978), 7, pp 526-539 22 Woods, W Semantics and quantification in natural language question answering In Advances ... Developing a natural language interface to complex data ACM Tr(uts on D=t~bsse ~l/stsrrts, (1978), 2, pp 105-147 I BaUard, B A "Domain Class" approach to transportable natural language processing ... phrase-structured grammatical formalism for transportable natural language processing, llm~r J Cow~p~t~zt~na~ L~n~ist~cs, to appear 24 Ginsparg, J A robust portable natural language data b a s...
- 5
- 452
- 0
Báo cáo y học: "Comparison of functional residual capacity and static compliance of the respiratory system during a positive end-expiratory pressure (PEEP) ramp procedure in an experimental model of acute respiratory distress syndrome" potx
... Rylander C, Hogman M, Perchiazzi G, Magnusson A, Hedenstierna G: Functional residual capacity and respiratory mechanics as indicators of aeration and collapse in experimental lung injury Anesth ... H2O (ARDS) after oleic acid injection During ARDS, inspiratory plateau airway pressure was significantly increased at a PEEP of 20 and 15 cm H2O (p < 0.05) Maximal oxygenation was obtained at a ... the analysis of variance resulted in p value < 0.05 (Statistica, Statsoft Inc., Tulsa, OK, USA) Correlations between FRC, static compliance, and PaO2 were evaluated by a Pearson's linear correlation...
- 6
- 275
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... Gal3p based on translocation and dimerization possibilities of Gal3p The steady- state response analysis rules out dimerization or translocation of Gal3p Further, the analysis clearly demonstrates ... parameters quantifying strength of interactions; and (d) spatial localization of protein in a compartment or shuttling of proteins between compartments It is evident that a large number of parameters ... mechanism of galactose mediated signal transduction Mol Microbiol 40, 1059–1066 24 Carey, M., Kakidani, H., Leatherwood, J., Mostashari, F & Ptashane, M (1989) An amino terminal fragment of Gal4p...
- 11
- 490
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... placenta (lanes and 2); skin (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane ... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC...
- 11
- 475
- 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
... orthopaedic and manual diagnostics, here for reasons of efficiency and usability of the system in routine occupational medical examinations, the measures are chosen according to the situation and ... strain on the bursa subacromialis and so in a typical case of "painful arc" the movement would cause less pain The most reliable test of internal and external rotation is carried out with the arms ... Screening of the thoracic and lumbar spine and the lumbar-pelvic-iliac region Screening of the thoracic and lumbar spine and the lumbar-pelvic-iliac region is carried out with the patient standing,...
- 10
- 575
- 0
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... testicular hyaluronidase (Sigma) After an incubation of 30 at 37°C and 5% CO2, the media was replaced and the incubation was continued at 37°C for an additional h Chondrocytes were centrifuged and ... strain in the central region of the sponge was nearly constant This constant strain in the central region was consistently 1/2 of the overall strain values across a wide range of overall strain ... captured in the unstretched and maximally stretched state at each power setting in 16-bit gray-scale at 16× magnification using a Polaroid DMC2 digital microscope camera (Polaroid, Wayland, MA, USA)...
- 10
- 546
- 0
Báo cáo lâm nghiệp: "Evolution of the mineral fertility of an acidic soil during a period of ten years in the Vosges mountains (France). Impact of humus mineralisation" pps
... Gelhaye and Daniel Imbert; to Saïd Belkacem and the INRA laboratory in Arras for mineral soil analyses, to the INRA laboratory in Bordeaux (L.E.R.M .A. V.E.) for organic horizon analyses; to Jacques ... How can this decrease in Ca and Mg be explained? In order to answer that question, the quantities of Ca, Mg and K incorporated in the woody biomass and the increasing needle biomass (as explained ... soil of this observation plot was analysed in 1986 and again in 1996, and the results were compared with a nutrient balance in the forest ecosystem As a result of that comparison, an acidification...
- 8
- 334
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
... excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy of the calculated sub-stomatal CO2 mole fraction (ci) On a chlorophyll ... mol -1 In +Al, –CaMg and +Al–CaMg plants, gw at ca = 900 µmol mol-1 was significantly lower than in controls (–36%) Stomata of both +Al and –CaMg plants remained wide open with lowering ca On the ... [1, 14] and Vicia faba [30] On the other hand, steady state stomatal conductances (gw) in light was significantly reduced by the deficiency in Ca and Mg, and accompanied by a lower ratio in K concentration...
- 10
- 376
- 0
Báo cáo khoa học: "Hybridization and mating system in a mixed stand of sessile and pedunculate oak" pptx
... mantained? In this paper patterns of hybridization and of the mating system of Q petraea and Q robur have been inferred from examination of allozyme variation in cohorts of a stand comprised of both ... 1989, and germinated in an incubator Technical procedures and genetic interpretations are described in detail in Kremer et al (1991) and Zanetto et al (1993) We stained and then scored enzyme systems ... form a barrier to gene flow, but in the intermediate habitats the species are in contact and it is there that one can find the greatest number of intermediate forms (Grandjean and Sigaud, 1987)...
- 6
- 256
- 0
Báo cáo khoa học: " Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II study" docx
... conception and design, acquisition of data, analysis and interpretation of data; involvement in drafting and reviewing the manuscript JO: contribution to acquisition of data, analysis and interpretation ... indicate that neoadjuvant capecitabine chemoradiotherapy is an effective treatment for patients with LARC and the incorporation of bevacizumab into a standard capecitabine-based chemoradiotherapy ... interpretation of data MM: contribution to acquisition of data, analysis and interpretation of data MB: contribution to acquisition of data FA: contribution to acquisition of data, analysis and interpretation...
- 8
- 474
- 0
Báo cáo y học: "Frequent CXCR4 tropism of HIV-1 subtype A and CRF02_AG during late-stage disease - indication of an evolving epidemic in West Africa" docx
... Denmark) according to the manufacturer’s instructions using primers JE12F (5’-AAAGAGCAGAAGATAGTGGCAATGA-3’) and V 3A_ R2 (5’-TTACAATAGAAAAATTCTCCTCYACA-3’) for one-step RT-PCR and E2 0A_ F (5’-GGGCTACACATGCCTGTGTACCYACAG-3’) ... study, participated in analyzing and in interpretation of the data, and helped to draft the manuscript All authors read and approved the manuscript Competing interests The authors declare that they ... Biological and genetic characteristics of HIV infections in Cameroon reveals dual group M and O infections and a correlation between SI-inducing phenotype of the predominant CRF02_AG variant and...
- 13
- 240
- 0
Báo cáo khoa học: "Efficacy and safety of a low-flow veno-venous carbon dioxide removal device: results of an experimental study in adult sheep" pps
... none of them demonstrated a clear superiority and became the standard Pharmacologic approaches included nitric oxide inhalation, surfactant replacement therapy, antioxidants, prostaglandins, and ... experiments and data acquisition MV conducted experiments, interpretation of data, and manuscript drafting GB performed study conception and design, statistical analysis and interpretation of data, and ... bypass, collecting preliminary data in an animal model about the efficacy of the system, haemodynamic stability, and occurrence of adverse events Materials and methods Seven healthy adult female...
- 7
- 287
- 0
Báo cáo y học: "Evaluation of an ambulatory system for the quantification of cough frequency in patients with chronic obstructive pulmonary disease" ppsx
... laboratory and requires labor intensive analysis and interpretation [11-15] We evaluated a novel ambulatory cardio-respiratory monitoring system with an integrated unidirectional, contact microphone, and ... derived intervals [25] Results A satisfactory fit of the available standard sizes of the respiratory inductance plethysmography (RIP) garment was achieved in all patients and the system was well ... confined to any one space and ambulated, spoke on the phone, dined and performed additional activities of daily living A substantial challenge in this study was the choice of a reference standard with...
- 7
- 315
- 0
Báo cáo y học: "Management of severe crush injury in a front-line tent ICU after 2008 Wenchuan earthquake in China: an experience with 32 cases" pot
... injury are in a state of hypotension and need intravenous administration of a large volume of fluids, including artificial plasma, 5% glucose, NaHCO3, aescigenin, and human serum albumin Colloid ... front-line ICU for major disasters Advantages of front-line ICU after an earthquake A front-line ICU is very important for treatming crush injury patients after disasters such as an earthquake, because ... had chest trauma, had cerebral trauma, had splenic rupture, had open tibia fracture, had spinal injuries, and had perinephrium and retroperitoneal hematoma The mean entrapment period of the patients...
- 8
- 386
- 0
project on Application of Disperse & Reactive Dyes In a P-C Blended Fabric of 65-35 In Using Two Bath System
... other and fed into the blending feeder The blending can also be done in the carding stage Similarly the blending can be done at drawing or roving stage A filament yarn blended contains yarns of ... effect Appearance: The attainment of attractive appearance using combination of yarns of different luster, crimp etc which differ in appearance even after dye uniformly to the same color Dyeing ... bonds are produced They have excellent wash fastness Mainly used on cotton dyeing Can also be applied on wool, silk and nylon dyeing Dyeing is carried out in an alkaline bath By achieving Practical...
- 30
- 463
- 0
Development of an intelligent electrolytic in process dressing (ELID) grinding system 1
... wheel have their own advantages and disadvantages The comparative analysis of all these processes can be understood from the table 1.1 given below, Introduction Table 1.1: Comparative analysis of ... ways for achieving final finishing of different materials are lapping and polishing Though these methods have disadvantages like poor grindability, waste water problem, mechanical damages etc ... material becomes soft and is removed during grinding and ensures protrusion of new sharp grits Laser can also be used as a boosting method for mechanical contact dressing In this case laser softens...
- 11
- 238
- 0
- flow of data and information in a computer system
- flow of data and information in a computer system diagram
- the position of an object moving in a straight line
- what is the importance of management information system in an organisation
- what are the roles of management information system in an organisation
- explain the role of management information system in a multinational business organization
- what is the role of management information system in an organization
- what are the importance of management information system in an organisation
- show the structure of an xml document in a treeview
- reversible steady state flow processes
- reversible work of a closed system
- reversible work of an open system
- irreversibility of an open system
- exergy and rate of flow exergy change of an open system
- certification validation 1 process carried out by a cb leading to the issuance of a cc certificate 23 2 comprehensive evaluation of the technical and nontechnical security features of an it system and other safeguards made in support of
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25