responding to objectrelated misconceptions

... user's goal is a good source of information to use to determine the probable perspective, 102 The ROMPER System: Responding to Object-Related Misconceptions using Perspective 1 Kathleen ... a domain. This paper describes the ROMPER system (Responding to Object-Related Misconceptions using PERspec- tive) which is able to respond to certain classes of these mis- conceptions in a ... method does seem to be appealing, at first glance it seems to have a major flaw. It does not seem to take into account the role that previous context plays in correcting misconceptions. The...

Ngày tải lên: 24/03/2014, 02:20

Ngày tải lên: 26/11/2013, 13:21

... customers, positive word of mouth and fewer calls to call centres. But with customers increasingly taking to Twitter to escalate their unanswered issues – 40% of Air Asia’s unanswered customer ... thereafter regularly. Appear anxious to help, as opposed to desperate to please. Backing yourself into a rhetorical corner can prove awkward when you have to extricate yourself publicly. Be transparent. ... for Responding to Negative Online Comments Posted by:Charlie Pownall Please log in or register to follow this user. Like it? Posted December 30, 2012 Due to convenience, the opportunity to receive...

Ngày tải lên: 09/02/2014, 20:13

... implemented a policy to simply to have doctors admit mistakes and apologize. Since implementation, the average time to resolve com- plaints has decreased from 1000 to 300 days, attorney fees have ... was due to an error, the event still should be acknowledged and regret should be expressed as above. However, it is important not to jump to conclusions, to blame oneself or another, nor to take ... Management, April 2001, 20pp. Popp, Pamela L., “How To And Not To Disclose Medical Errors to Patients,” Managed Care, 11 (10) October 2002, p.52–3. Porto, Grena G., “The Risk Manager’s Role in Disclosure...

Ngày tải lên: 07/03/2014, 10:20

... attempts to avoid conflict are used. For example, a possitive politeness so as to agree or to hide disageement to respond to a preceding utterance with “yes, but….” in effect Eg: A: Shall we go to ... to return someone‟s phone call, therefore you say, “I tried to call a hundred times, but there was never any answer.” Chapter II: Suggesting and responding to suggestions Suggesting and responding ... we go to her house now?) 1.2 Indirect suggestion Indirect suggestion does not mention directly to messenger‟s content which speaker would like to convey to listener. The listener has to guest...

Ngày tải lên: 17/03/2014, 02:36

... 2. Responding to offers in Vietnamese: How to offer is very important in Vietnamese, and how to respond to offers is more important. In Vietnamese, there are many ways to respond to offer. ... yourself to some more wine. IV. Responding to offers in English and Vietnamese: 1. Responding to offer in English: When receiving an offer in English, the hearer has two ways of responding: ... like to see a movie?” There are several ways of refusing: - Thank you. I’d like to, but I have to work late. - Thank you, I’d love to, but I need to save money. - Thank you, I’d like to, ...

Ngày tải lên: 18/03/2014, 10:19

Ngày tải lên: 23/03/2014, 12:20

... in European countries. He is responsible for database implementation and Responding to the challenge of cancer in Europe xviii Responding to the challenge of cancer in Europe Source: WHO Mortality Databank Figure ... exposure to risk factors, in order to prevent as many cancers as possible; • detect as early as possible those cancers which could not be prevented; • give the best possible treatment and care to ... research that aims to identify the causes of cancer and to develop better strategies for prevention, diagnosis, treatment and cure. This book represents an attempt to bring together the latest...

Ngày tải lên: 28/03/2014, 23:20

... to happen, it needs to be straightforward for an event author to publish into VOEventNet, and easy for potential subscribers to discover that stream. Amateur astronomers will be encouraged to ... subscribe to other brokers, and then re-broadcast content to subscribers. This pattern could be used for a content aggregator or selector, perhaps taking the ‘best’ events relevant for a general topic ... history of collecting all the astrophysical transient events, converting them to a set of standard output formats, and distributing them by a set of standard protocols to whomever wants to receive...

Ngày tải lên: 30/03/2014, 16:20

... suggest what it considers to be a better alternative, leading to an embedded negotiation subdialogue. In addition to the evaluator, our architecture consists of a goal selector, an intentional planner, ... instead of directly responding to the user's utterances, conveys the disagreement. Thus, our work contributes to an overall dialogue system by 1) extending the model in [6] to eliminate the ... (one whose actions do not contribute to one another as intended)[9]. We argue that the evaluator, in order to check for erroneous plans/goals, only needs to examine actions in the proposed...

Ngày tải lên: 31/03/2014, 06:20

... response similar to naïve patients undergoing treatment for HCV. Methods: HRQOL data was obtained from 152 patients enrolled into a randomized study for re-treatment of HCV refractory to prior therapy ... scores were lower compared to baseline in non-responders. At 24 weeks post treatment follow up, HRQOL in those refractory patients who respond to re- treatment tended to be better than the national ... HCV refractory to prior therapy. One hundred and sixty-five patients with refrac- tory Hepatitis C were recruited from the 6 private practice centers and a tertiary care facility, The Milton S....

Ngày tải lên: 20/06/2014, 15:20

Ngày tải lên: 03/07/2014, 21:20

... with MKK6br3¢ to amplify the MKK6b ORF MKK6btoflf CACCATGGAGGGAGGGAGTGAGAAAGAAG For topo cloning of MKK6b into pENTR ⁄ D-TOPO MKK6btoflr TCAGTCCCCGAGGATGACCTT Reverse primer for MKK6btoflf MKK6cf2 ... in 3¢-UTR of MKK6a MKK6atoflf CACCATGTCTCTTTCTAAAGGAGGGAAGAA For topo cloning of MKK6a into pENTR ⁄ D-TOPO MKK6atoflrs TCAGTCTGCCAGGATGATCTTGACA Reverse primer for MKK6atoflf MKK6bf3¢ GAGAGATTAATCAGAAAGGC ... were highly similar to mammalian MKK6 sequences, and they were ubiquitously expressed. All three were shown to be upstream activators of salmon p38. In cells exposed to sorbitol, sodium arsenite...

Ngày tải lên: 24/03/2014, 00:21

Ngày tải lên: 03/08/2012, 13:25

Ngày tải lên: 03/08/2012, 13:43

Ngày tải lên: 03/08/2012, 21:04

Ngày tải lên: 03/08/2012, 21:05