Báo cáo Y học: Atlantic salmon possess three mitogen activated protein kinase kinase 6 paralogs responding differently to stress pot

Atlantic salmon possess three mitogen activated protein kinase kinase paralogs responding differently to stress ˚ Tom E Hansen1,2, Pal Puntervoll3, Ole Morten Seternes4 and Jorunn B Jørgensen1,2 Department of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromsø, Norway The Norwegian Structural Biology Centre (NorStruct), University of Tromsø, Norway Computational Biology Unit, Bergen Centre for Computational Science, Norway Department of Pharmacology, Institute of Medical Biology, University of Tromsø, Norway Keywords MAP kinase; MKK3; MKK6; p38; salmon Correspondence J B Jørgensen, Department of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromsø, N-9037 Tromsø, Norway Fax: +47 77 64 60 20 Tel: +47 77 64 67 16 E-mail: jorunn.jorgensen@nfh.uit.no (Received May 2008, revised 28 July 2008, accepted August 2008) doi:10.1111/j.1742-4658.2008.06628.x Mitogen activated protein kinase kinase (MKK) and are the main p38 mitogen-activated protein kinase activators in mammals In the present study, three Atlantic salmon MKK6 orthologs were identified The deduced amino acid sequences of the salmon MKK6 proteins were highly similar to mammalian MKK6 sequences, and they were ubiquitously expressed All three were shown to be upstream activators of salmon p38 In cells exposed to sorbitol, sodium arsenite and UV radiation, the different salmon MKK6s were shown to be selectively activated Thus, our results suggest a specific function of the three salmon MKK6s depending on which stress stimuli the cells are exposed to Phylogenetic analysis of MKK6 and MKK3 sequences from different species indicate that salmon is unique in having three MKK6 gene copies, whereas other fish species possess one or two MKK6 genes Interestingly, in contrast to mammals, fish not have an MKK3 gene We propose that two major duplication events have occurred for the ancestral MKK3 ⁄ gene: one in tetrapods yielding MKK3 and MKK6, and another one in fish yielding two MKK6 paralogs The third MKK6 copy found in salmon is probably the result of the salmonidspecific tetraploidization event In conclusion, we report for the first time in any species the existence of three MKK6 genes displaying distinct expression and activation patterns Furthermore, MKK3 is dispensable in some vertebrates because it is absent from fish genomes despite being present in chicken and all mammals sequenced so far The p38 group of mitogen-activated protein kinases (MAPKs) is activated by pro-inflammatory cytokines and environmental stress [1] We have recently cloned three different Atlantic salmon (Salmo salar) p38 cDNA variants (As-p38a, b1 and b2) [2] All three variants were phosphorylated after treatment of cells with the stressors sodium arsenite and sorbitol Additionally, the pro-inflammatory stimulants bacterial lipopolysaccharide (LPS), CpG oligonucleotides and the cytokine interleukin (IL)-1 were shown to activate the p38 signalling pathway in salmon macrophages The inhibition of tumor necrosis factor (TNF)-2 and IL-1b expression in LPS stimulated salmon macrophages by the p38 specific inhibitor SB203580, highlights the importance of p38 in the regulation of cytokine expression also in fish The activation of the MAP kinase pathway is achieved through a three component protein kinase Abbreviations As, Atlantic salmon; CHSE, Chinook salmon embryo; eEF2, eukaryotic elongation factor 2; EST, expressed sequence tag; GFP, green fluorescent protein; GST, glutathione S-transferase; IL, interleukin; LPS, lipopolysaccharide; MAP3K, MAPK kinase kinase; MAPK, mitogenactivated protein kinase; MKK, MAP kinase kinase; TNF, tumor necrosis factor FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4887 Atlantic salmon MKK6 orthologs T E Hansen et al cascade consisting of the MAPK kinase kinase (MAP3K), the MAPK kinase (MKK or MAP2K) and the MAPK The MAPKs are activated upon phosphorylation of Thr and Tyr in the activation loop by specific MKKs [1,3,4], whereas the MKKs are activated by phosphorylation of their Ser and Thr residues in the activation loop by MAP3Ks [5] Once activated, the MAPKs may translocate into the nucleus and phosphorylate specific target molecules on Ser or Thr residues Activated MAPKs phosphorylate a wide array of targets localized both in the cytoplasm and the nucleus, including transcription factors and other kinases that facilitate the transcription of MAPK regulated genes [6] The principal MKKs for p38 in mammalian cells are MKK3 and MKK6 and, in some cases, MKK4 [7] MKK substrate specificity is mediated by the interaction motif located in the N-terminal part of the kinase [8–12] Four p38 isoforms, a, b, c and d, are found in mammalian species and a selective activation of each of the isoforms by MKK3 [13,14] and MKK6 has been reported [15–18] MKK6 and MKK3b activate all four p38 members, whereas MKK3 activates all except p38b [13–16,18–23] MKK4, which primarily activates c-Jun N-terminal kinase, is shown to participate in the activation of p38 under certain type of stress [7] Altogether, this selective recognition by different MKKs and MAPKs highlights some of the complexity of the mammalian MAPK cascade Mouse knockout experiments have been useful in defining the physiological roles for MKK3 and MKK6 Although mice lacking either MKK3 or MKK6 are viable, the disruption of both will result in death during early development [7,24–26] Single disruption of MKK3 has revealed an essential role for this kinase in the regulation of TNF-a induced cytokine expression in embryonic fibroblasts and IL-12 production in LPS-stimulated macrophages [24,25] Targeted deletion of MKK6 in mice shows impaired deletion of double positive thymocytes [26] Analysis of fibroblast from mice lacking both MKK3 and MKK6 demonstrates redundant but also essential roles for MKK3 and MKK6 in mediating TNF-a stimulated p38 activation By contrast, MKK3 and MKK6 are not essential for UV-induced p38 activation [7] The MAPK signaling pathway is highly conserved through evolution and MKK homologues have been identified in both vertebrates [21,23,27–31] and invertebrate species [32], and also in yeast [33] In fish, two MKKs from the MKK3 ⁄ family have been cloned: one from carp (Cyprinus carpio) and one from zebrafish (Danio rerio) [27,29] In the present study, we have identified and characterized three Atlantic salmon MKK cDNAs: Atlantic salmon MKK6a (AsMKK6a), As-MKK6b and As-MKK6c Results Cloning of As-MKK6a, As-MKK6b and As-MKK6c With degenerated primers and RACE-PCR, we were able to amplify a cDNA encoding 336 amino acids showing the strongest amino acid similarity to human MKK6 (85% identity) The sequence was given the name As-MKK6a (GenBank accession number AY641477) A blast analysis in the NCBI database with the As-MKK6a sequence revealed the presence of two rainbow trout expressed sequence tag (EST) clones with high similarity to As-MKK6a Based on the sequences of the two ESTs, we were able to clone two other MKK cDNAs that encoded a 357 amino acid protein (As-MKK6b; GenBank accession number EU234532) and a 359 amino acid protein (As-MKK6c; GenBank accession number EU234533) The As-MKK6b and As-MKK6c showed 93% nucleotide sequence identity, respectively The nonmatching nucleotides were spread throughout the whole ORF, which suggests that As-MKK6b and As-MKK6c represent two MKK6 isoforms The predicted sizes of the As-MKK6 proteins were 38 kDa (As-MKK6a) and 40 kDa (As-MKK6b and As-MKK6c) An alignment of the As-MKK6 sequences and selected MKK6 sequences from other species is shown in Fig 1A Note Fig Alignment of MKK6 sequences and the phylogenetic tree of MKK3 and MKK6 sequences (A) The multiple sequence alignment of selected MKK6 sequences is shown, emphasizing any differences Identical amino acid residues are denoted by dots, different residues are shown in lowercase, and gaps are shown as hyphens The conserved phosphorylation site residues Ser and Thr lying within subdomain VIII are marked by arrows, and the conserved N-terminal p38 docking motif [(R ⁄ K)2-(X)2-6-L ⁄ I-X-L ⁄ I] is framed by a grey box (B) The phylogenetic tree was built from an extended alignment that included additional MKK6 sequences and selected MKK3 sequences Clade credibility values are indicated, and the insect MKK3 ⁄ sequences were used as outgroup For clarity, non-salmon fish sequences occurring in the same clade as As-MKK6a were named MKK6a and those clustering with As-MKK6b were named MKK6b The accession numbers for the sequences used are: MKK3 ⁄ 6: drosophila, Q9U983; mosquito, Q7PRZ7; ciona, Q4H382 MKK3: chicken, Q5ZL06; cow, A4IFH7; mouse, O09110; human, P46734 MKK6a: tetraodon, Q4SGJ8; fugu, SINFRUP00000137389; stickleback, ENSGACP00000014471; medaka, ENSORLP00000009468 MKK6b: tetraodon, Q4S8I5; fugu, SINFRUP00000128869; medaka, ENSORLP00000017352; carp, Q9I959; zebrafish, Q6IQW6 Sequences were retrieved from UniProt (six character long accession numbers) or ENSEMBL 4888 FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al Atlantic salmon MKK6 orthologs A B FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4889 Atlantic salmon MKK6 orthologs T E Hansen et al that the salmon MKK6 sequences contain both the N-terminal p38 MAPK docking motif and the phosphorylation sites lying within subdomain VIII A Phylogenetic analysis of MKK3 and MKK6 sequences The initial blast searches performed with the As-MKK sequences suggested the need for a thorough phylogenetic analysis of the two closely related MKK3 and MKK6 sequence families from mammals and fish for two reasons First, although the As-MKK6 sequences are more similar to human MKK6 (80–85% identity) than MKK3 (73–74% identity), the most closely related zebrafish sequence (80–87% identity) was first named MKK3 [27] Second, the initial blast searches indicated that, in contrast to salmon, zebrafish and carp only appear to have one copy of the MKK3 ⁄ gene A phylogenetic tree was constructed for the MKK3 ⁄ sequences as described in the Experimental procedures (Fig 1B) Two equally striking observations can be made from the tree First, MKK3 does not appear to be present in fish Second, the MKK6 gene appears to have undergone duplication in fish: all six fish species analysed have at least one MKK6 gene; green pufferfish, fugu and medaka have two copies; and salmon is the only species with three copies Hence, a second duplication appears to have occurred in salmon, resulting in As-MKK6c and As-MKK6b Tissue distribution of As-MKK6a, As-MKK6b and As-MKK6 By northern blotting, a 4.0 kb transcript representing As-MKK6a was detected in all the tissues tested with the highest expression in the ovary Two smaller transcripts of 1.7 kb and 1.4 kb were also found in the ovary The 1.7 kb transcript was detected as a faint band in the other organs tested (Fig 2A) By using a probe encompassing the entire coding region of As-MKK6b, we revealed only a single transcript of approximately 1.7 kb showing equal expression levels in all tissues examined (Fig 2B) Due to the high sequence similarity between MKK6b and c, it is likely that the MKK6b probe detects both these transcripts on the northern blot To distinguish between them, RT-PCR with primers specific for MKK6a, b and c were designed and used for expression analysis The RT-PCR was performed with mRNA from the same tissues and mRNA from macrophages (Fig 2C) and, consistent with the northern analysis, all three As-MKK genes were shown to be expressed in these 4890 B C Fig Tissue expression analyses of salmon MKK6a, MKK6b and MKK6c (A) A blot containing poly(A)+ RNA isolated from various salmon tissues was hybridized with probes specific for either As-MKK6a (upper panel) or (B) As-MKK6 b ⁄ c (upper panel) b-actin expression was used as a loading control in (A) and (B) (lower panels) (C) Expression of the As-MKK6a, b and c in various tissues and in head kidney macrophages examined by RT-PCR, using MKK6a, b and c specific primers tissues The expression of MKK6a was predominant in the liver compared to MKK6 b and c Analysis of MKK6 expression in head kidney macrophages revealed that only As-MKK6a and c were detected in these cells As-MKK antibody specificity The specificity of the As-MKK6a, b and c antibodies was tested by western blot analysis of immunoprecipitated myc-tagged MKK6a, b and c constructs expressed in Chinook salmon embryo (CHSE)-214 cells The purified antiserum raised against the PPPHQSKGEMSQPKG peptide showed specificity to As-MKK6b ⁄ c, but not to As-MKK6a (Fig 3A), and FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al A Atlantic salmon MKK6 orthologs B C Fig Antibody specificity against As-MKKs (A) CHSE-214 cells were transfected with expression vectors encoding either As-MKK6a wid-type (wt), 6b wt or 6c wt containing an N-terminal myc epitope tag After 48 h, the cells were lysed and the myctagged proteins were immunoprecipitated using myc antibody The immunoblots of precipitated wt myc-MKKs were examined using anti-pan-MKK6 (recognizing As-MKK6a, b and c, upper panel), antiMKK6b ⁄ c (recognizing As-MKK6b and c, middle panel) and antimyc sera (lower panel) Primary salmon macrophages were harvested and As-MKK6a, 6b and 6c were visualized by western blotting of whole cell extract using anti-As-MKK6b ⁄ c (B) and antipan-MKK6 sera (C) Similar results were obtained in two separate experiments Phosphorylation of As-MKKs by UV irradiation The MKKs are phosphorylated and activated by MAP3Ks [5] The C-terminal part of MKKs contains a stretch of approximately 20 amino acids immediately on the C-terminal side of the MKK catalytic domain reported to be important in the docking of the MAP3Ks to the MKKs [34] Similar C-terminal docking sites sequences are present in the three As-MKKs To investigate whether the As-MKKs are phosphorylated at Ser and Thr residues within subdomain VIII of the activation loop, a specific antibody to phosphorylated Ser189 of human MKK3 and Ser207 of human MKK6 was used CHSE-214 cells were transfected with myc-tagged MKK wild-type constructs and UV radiated for 30 min, followed by immunoprecipitation of the tagged MKKs UV irradiation is a cellular stressor known to engage multiple signalling pathways ending in p38 activation [35] As shown in Fig 4, all three As-MKKs were phosphorylated in UV radiated CHSE-214 cells The amount of phosphorylated As-MKK6b was considerably lower (Fig 4B) than the amount of As-MKK6c (Fig 4C) and 6a (Fig 4A) Phosphorylation of As-MKK6b was not detected in the total lysate, whereas phosphorylated As-MKK6c A B was named anti-MKK6b ⁄ c By contrast, the purified antiserum raised against the SQPKGGKRKPGLKLS peptide recognized all three As-MKKs and was named anti-pan-MKK6 These antisera were tested on lysate from primary nonstimulated macrophages (Fig 3B,C) A band at the predicted size of As-MKK6b ⁄ c (40 kDa) was detected using the As-MKK6b ⁄ c antibody in these cells (Fig 3B) This band most likely represents MKK6c because RT-PCR analysis revealed that MKK6b was not expressed in macrophages (Fig.2C) In addition, a faint band at the same size as As-MKK6a was apparent in the macrophages Whether this band represents another salmon MKK6 variant or is due to unspecific binding in not known The pan-MKK6 antibody recognized two proteins with the predicted sizes of As-MKK6b ⁄ c and 6a (Fig 3C) These results show that the peptide antibodies raised against the As-MKK6s, despite some cross-reactivity, can be used to detect salmon MKKs in tissues and cells C Fig As-MKK6a, b and c are phosphorylated upon stress treatment CHSE-214 cells were transfected with myc-MKK6a wild-type (wt) (A), myc-MKK6b wt (B) and myc-MKK6c wt (C) At 48 h post transfection, the cells were treated with 120 mJỈcm)2 of UV radiation (30 min) or left untreated Cell lysates were harvested and wt myc-MKKs were immunoprecipitated (IP) from the cell lysates The immunoblot of the whole cell extracts (WCE) and IP myc-MKKs wt were analysed by anti-p-MKK3 ⁄ (p-MKK; upper and middle panel) and anti-myc (lower panel) sera FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4891 Atlantic salmon MKK6 orthologs T E Hansen et al and 6a were found in the same lysate, and the latter two were even detected in the nonstimulated cells These results indicate that As-MKK6b are poorly phosphorylated in UV radiated CHSE-214 cells compared to As-MKK6c and 6a A B Ectopically expressed As-MKK6a, b and c are differently activated by diverse types of stress The p38 signalling cascade is activated by diverse classes of stress [1,28,36] To explore the activation of salmon MKKs by different stressors, CHSE-214 cells over-expressing myc-tagged MKK6a, b or c were treated with sodium arsenite or sorbitol for 30 Sodium arsenite is a oxidative stress inducer that activates p38 [37,38], whereas sorbitol induces osmotic stress [39] A time course over 60 with the same type of treatments and also including UV radiation for 30 was performed for As-MKK6a transfected cells The kinase activity of immunoprecipitated myctagged proteins was assayed using recombinant Hisp38a as MKK substrate High MKK6a activity was detected for all three stress treatments (Fig 5A) The time course of sodium arsenite treatment revealed no activity before 15 post treatment and the activity remained at the same level to 60 post treatment In sorbitol treated cells, As-MKK6a activity was detected at post treatment and the activity remained from 15–60 post treatment Sorbitol treatment gave also strong As-MKK6b activation, whereas a modest change in the As-MKK6b activity was detected upon sodium arsenite treatment (Fig 5B) Interestingly, the results for As-MKK6c were opposite, whereas the addition of sodium arsenite to the cells induced activation was sorbitol ineffective (Fig 5C) The latter suggests that sodium arsenite is a poor MKK6c activator UV radiation was capable of activating both As-MKK6b and c (results not shown) The differences cannot be attributed to variability in protein expression because western blot analysis of cell extracts detected equal amounts of total myc-tagged As-MKK6s The observed difference in As-MKK6a, b and c activation by different stimuli suggests that these salmon MKK6s are differentially regulated Sorbitol induced activation of p38 in salmon TO cells does not require MKK6a, b or c The phosphorylation of endogenous MKKs was examined in TO cells using the commercial MKK3 ⁄ phospho-specific antibody By sodium arsenite stimulation, one band was detected with a regular substrate, whereas three different bands were detected with a 4892 C Fig Activation of As-MKKs by diverse stress (A) CHSE-214 cells were transfected with myc-tagged As-MKK6a wild-type (wt) expression vector and treated with sodium arsenite (SA; 250 lM), sorbitol (0.3 M), UV radiation (120 mJỈcm)2) for indicated time points, or left untreated Cells were lysed and myc-tagged proteins were immunoprecipitated from the whole cell extracts (WCE) followed by an in vitro kinase assay (KA) using salmon His-As-p38a as a substrate As-MKKs activities were analyzed by western blot analysis detecting phosphorylated His-As-p38a (B) CHSE-214 cells were transfected with myc-tagged As-MKK6b wt expression vector and treated with sodium arsenite (SA; 250 lM), sorbitol (0.3 M), or otherwise as in (A) (C) CHSE-214 cells transfected with myctagged As-MKK6c wt expression vector, or otherwise as in (A) Phosphorylated His-As-p38a was detected by immunoblotting using anti-phospho-p38 serum (p-p38; upper panel) and exogenously expressed myc-MKKs was detected in cell extracts using anti-myc serum (lower panel) Experiments were performed twice with reproducible results ultrasensitive substrate, varying in size in the range 38–44 kDa (Fig 6A) Band in Fig 6A, with an approximately size of 38 kDa, may correspond to MKK6a An increased phosphorylation of the band was detected already after and the phosphorylation was more or less constant over the whole time course Another band of approximately 40 kDa was detected after 15 (Fig 6A, band 2) This band corresponded in size to MKK6b or 6c RT-PCR results obtained with primers specific for As-MKK6b and 6c showed that neither MKK6b nor MKK6c was expressed in TO cells (results not shown), which excludes the possibility that band represents these MKK6 variants The phospho-MKK3 ⁄ antibody is known to weakly cross react with phosphorylated MKK4 [7] A third band (Fig 6A, band 3) was detected in the experiment, which corresponds to the size of MKK4 (approximately 44 kDa) and may represent a salmon MKK4 ortholog In sorbitol stimulated FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al Atlantic salmon MKK6 orthologs A B C D Fig Sorbitol induced activation of p38 MAPK in TO cells does not involve any of the MKK6 paralogs (A) TO cells were treated with sodium arsenite (250 lM), sorbitol (0.3 M) at indicated time points, or left untreated Cells were harvested and phosphorylated As-MKK6a, b, c (p-MKK, first and second panel) and were visualized by western blotting using regular substrate (West Pico) or ultrasensitive substrate (West Femto) respectively Protein loading was verified in the whole cell extracts using the anti-eEF2 serum (lower panel) Phosphorylated As-p38a was detected by immunoblotting using anti-phospho-p38 serum (p-p38; third panel) (B) TO cells were either treated with 250 lM sodium arsenite or left untreated Cells were harvested at indicated time points and endogenous As-MKK6a, b and c were immunoprecipitated with anti-pan-MKK6 from the whole cell extracts (WCE) Activities were detected by kinase assay (KA) using His-As-p38 as substrate Phosphorylated His-As-p38a was detected by immunoblotting using anti-phospho-p38 serum (p-p38; upper panel) and eEF2 was detected from whole cell extracts (lower panel) (C) TO cells were transfected with myc-tagged As-MKK6a wild-type expression vector After 48 h, the cells were treated with 250 lM sodium arsenite, 0.3 M sorbitol for 30 min, or left untreated Cells were lysed and myc-tagged proteins were immunoprecipitated from the lysate followed by an in vitro kinase assay Phosphorylated His-As-p38a was detected by immunoblotting using anti-phospho-p38 serum (p-p38; upper panel) To confirm exogenous protein expression, the whole cell extract were blotted and probed with anti-myc serum (lower panel) (D) TO cells were transfected with GFP tagged As-p38a After 48 h, the cells were treated with 10 lM SB203580 for h or left untreated, followed by stimulation with 250 lM sodium arsenite (SA) or 0.3 M sorbitol for 30 Cells were lysed and phosphorylated GFP-p38a were detected by immunoblotting using anti-phospho-p38 serum (p-p38; first panel) The expression of GFPp38a was verified with anti-GFP (second panel) Phosphorylation of endogenous MK2 was detected with anti-phospho-MK2 (third panel) and anti-eEF2 (fourth panel) was used as a loading control Experiments were performed twice with reproducible results TO cells, only the 38 kDa band was detected at levels comparable with the control, indicating that this stimulant did not induce MKK6 phosphorylation (Fig 6A) Interestingly, although we were unable to detect any MKK6 activation upon sorbitol treatment, it was shown to phosphorylate salmon p38 (Fig 6A) Sodium arsenite activation of endogenous MKK6 in TO cells was further demonstrated by measuring the ability of MKKs to phosphorylate p38 in vitro The MKKs were immunoprecipitated by the pan-MKK6 antibody before measuring their ability to phosphory- late p38 Figure 6B shows that higher p38 phosphorylation by salmon MKK6a was observed at 50 post stimulation compared to the activity at 20 of stimulation A kinase assay of sodium arsenite and sorbitol stimulated TO cells over-expressing As-MKK6a revealed that only sodium arsenite activated As-MKK6a in TO cells (Fig 6C) These results are in agreement with the results shown in Fig 6A, where no endogenous MKK phosphorylation was detected in sorbitol stimulated TO cells Activation of p38 independently of MKK3 ⁄ 6, but dependent on p38 autophosphorylation, has been FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4893 Atlantic salmon MKK6 orthologs T E Hansen et al reported previously [40,41] Because the p38 specific inhibitor SB203580 blocks the ability of p38 to be autophosphorylated [42], we further examined whether this inhibitor would prevent p38 phosphorylation in stress-activated TO cells As shown in Fig 6D, p38 phosphorylation was not affected by the SB inhibitor, suggesting that p38 activation in sorbitol stimulated TO cells is not due to p38 autophosphorylation Salmon MKK6a, As-MKK6b and As-MKK6c activate As-p38a, As-p38b1 and As-p38b2 in CHSE-214 cells B The p38 MAP kinases are known substrates for MKK3 and MKK6 in mammalian cells [13,15,16,19– 21,23] We have recently described three p38a variants in Atlantic salmon, which all possess the putative dual phosphorylation motif Thr-Glu-Tyr in the activation loop as well as the docking motifs reported to be important for docking to activators, substrate and regulators Moreover, all three As-p38a variants were shown to be phosphorylated in CHSE214 cells stressed with sodium arsenite [2] To explore the ability of As-MKK6a, As-MKK6b and As-MKK6c to activate the different As-p38 variants, constitutively active As-MKKs were constructed Mammalian constitutive active MKK3 ⁄ is generated by replacing the phosphorylation sites Ser and Thr with the phospho-mimicking glutamic acid (EE) [43] Constitutive active As-MKKs were generated based on the same principle Furthermore, catalytic inactive As-MKKs mutants were constructed by replacing the aspartic acid in the conserved DFG motif, known to be essential for catalytic activity [44], with alanine (DA) CHSE-214 cells were co-transfected with glutathione S-transferase (GST)-MKK EE or DA and myc-tagged p38 variants, followed by immunoprecipitation and p38 kinase assay using recombinant ATF2 as substrate All three As-p38 variants were activated by constitutive active As-MKK6a, As-MKK6b and As-MKK6c (Fig 7) As-MKK6b caused the strongest As-p38a activation among the three MKKs (Fig 7A, upper panel), whereas As-MKK6c was the dominant activator of As-p38b1 (Fig 7B, upper panel) In the case of As-p38b2, all three MKKs showed similar levels of activation (Fig 7C, upper panel) The ability of the immunoprecipitated p38 to phosphorylate ATF-2 in vitro correlated well with results from western blotting using phospho-p38 antibodies to detect the exogenous and endogenous p38 phosphorylation directly in the lysates of transfected cells (data not shown) 4894 A C Fig As-MKK6a, b and c are upstream activators of As-p38a, p38b1 and p38b2 CHSE-214 cells were transfected with GSTtagged constitutive active (EE) or catalytic inactive (DA) MKK6a, b or c expression vectors together with either myc-tagged As-p38a (A), As-p38b1 (B) or As-p38b2 (C) After 24 h, the cells were lysed and myc-tagged p38 was immunoprecipitated from the whole cell extracts (WCE) lysate followed by an in vitro kinase assay (KA) using ATF-2 as p38 substrate The As-p38 activity was analyzed by detecting incorporated phosphate into ATF-2 by autoradiography (first panel) To confirm exogenous protein expression, the whole cell extract were blotted and probed with anti-GST (second panel) and anti-myc (third panel) sera Discussion In the present study, we report the cloning of three cDNAs encoding different salmon MKK6 sequences The identity between the As-MKK6b and 6c was 94%, whereas their identities to MKK6a were approximately 81% Because the nonmatching nucleotides in the sequences of these MKKs were spread throughout the whole ORF, it is unlikely that the different MKK6 FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al cDNAs represent different splice variants Thus, our data suggest that there exist at least three MKK6 genes in salmon They all contained the phosphorylation sites Ser and Thr in the activation loop and also the N- and C-terminal docking domains shown to be important for MKK activation and substrate specificity Further analysis of the salmon MKK6s revealed that they all were able to phosphorylate and activate salmon p38 In higher vertebrates such as man and mouse, the two genes MKK3 and MKK6 encode proteins that are the primary p38 activators, whereas in invertebrates such as Drosophila, Caenorhabditis elegans and in yeast, there are only a single activator for their p38 orthologs [32,33,45] A single MKK3 ⁄ ortholog has been described in the fish species carp and zebrafish that causes selective activation of p38 in vitro [27,29] Our phylogenetic analysis suggests that the ancestral MKK3 ⁄ gene has undergone two major duplication events (Fig 1B), one of the events can be observed in tetrapods, which have MKK3 and MKK6, and the other can be observed in fish which have one or two copies of MKK6 Hence, MKK3 does not appear to be present in fish, and the zebrafish MKK3 sequence should be renamed to MKK6, which is in agreement with the name given this sequence in the ZFIN and UniProt databases Salmon appears to be unique in having a third MKK6 copy, possibly reflecting the salmonid specific tetraploidization event [46] and, to our knowledge, this is the first report of the existence of three MKK6 isoforms in any species Inspection of the genomic sequences of five fish species (zebrafish, green pufferfish, fugu, medaka and stickleback) revealed evidence that may suggest that the two MKK6 sequences present in some fish may be the result of the early ray-finned fish tetraploidization event (results not shown) In green pufferfish and medaka, the two fish species that have two copies of the MKK6 gene and where the chromosomal location is known, the two MKK6 copies are located on different chromosomes This is in contrast to the human genome where MKK6 and MKK3 are located on the same chromosome Furthermore, all MKK6 genes, for which genomic sequence is available, are in synteny with a gene encoding a protein homologous to the human G protein-coupled receptor family C protein (UniProt: Q9NQ84) All three salmon MKK6 genes showed ubiquitous tissue distribution and almost similar expression levels in the different tissues analyzed The transcript length of MKK6b and 6c was approximately 1.7 kb, whereas the MKK6a probe revealed an approximately 4.0 kb transcript and two smaller transcripts of approximately Atlantic salmon MKK6 orthologs 1.4 kb and 1.7 kb, respectively The latter two were mainly expressed in the ovary However, we cannot exclude the possibility that these transcripts represent other closely related MKKs or are MKK6a splicing variants Due to the high identity between MKK6a and MKK6b ⁄ c (approximately 81%), the MKK6a probe may also weakly hybridize to the MKK6b ⁄ c transcript The 1.7 kb band seen with the MKK6a probe could therefore represent the MKK6b ⁄ c transcript The distribution of the salmon MKK6s resembles the wide tissue distribution of salmon p38 [2] In addition to its involvement in responses to stress and inflammatory stimuli, the p38 kinase signaling pathway also participates in processes during normal development Zebrafish p38 is involved in the control of blastomere cleavage during embryogenesis [27,29] and a specific temporal expression pattern is seen in throughout zebrafish embryogenesis [47], suggesting an important role during early development Studies on salmon [2] and carp [29] have demonstrated high expression of both p38 and MKK6 in the ovary The abundance of piscine p38 signalling module members in this organ may suggest that the p38 pathway aids their survival against environmental stresses during early development Carp MKK6 possess a nuclear export signal sequence that does not exist in the MKK3 ⁄ families in other species [29] Such a nuclear export signal was not found in the salmon MKK6 sequences reported in the present study In salmon, three genes encoding p38a isoforms have been identified and all three were activated by stressinducing and inflammatory stimuli The existence of several p38 genes in salmon may be a way for cells to respond differently to upstream kinases and extracellular stimuli, which also has been reported in other studies [8,20] Using constitutively activated MKK6 mutants, we were able to demonstrate that all three MKK6s variant could activate the different salmon p38 variants This was shown by a kinase assay detecting ATF-2 phosphorylation Furthermore, the results were verified using a GAL4-responsive and ATF2 dependent luciferase reporter assay, where overexpressing constitutive active As-MKKs mutants increased ATF2-dependent gene expression by six- to 10-fold compared to catalytic inactive As-MKKs mutants (data not shown) Analysis of p38 activation in mouse fibroblasts lacking MKK3 or MKK6, and stressed with UV radiation, anisomycin or sorbitol, shows that mammalian MKK6 and MKK3 play redundant roles in response to these stressors [7,24,48] Despite a very high identity between the salmon MKK6s, their activation pattern upon exposure to different stressors revealed differences We FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4895 Atlantic salmon MKK6 orthologs T E Hansen et al found considerably more phosphorylated MKK6a and 6c compared to MKK6b in UV stressed CHSE-214 cells over-expressing the three As-MKK6s Moreover, exposure to the stressors sorbitol and sodium arsenite resulted in notable differences in response between the MKK6 isoforms, as measured by their kinase activity using recombinant salmon p38 as substrate For MKK6b, the activation by sorbitol was much more pronounced compared to sodium arsenite, whereas it was the opposite for MKK6c Moreover, As-MKK6a responded equally to these stressors The results suggest a selective activation of As-MKK6 by extracellular stimuli, and surmise that different MAP3Ks are involved in MKK6 activation in response to alternate forms of stress It is interesting that p38 is the only substrate for the MAP2Ks MKK3 and MKK6, whereas a much wider repertoire of different MAP3Ks having the ability to phosphorylate and activate MKK3 and MKK6 exist [35] A C-terminal docking site called the DVD domain (i.e domain for versatile docking) consisting of 24 amino acids is essential for activating mammalian MKKs by specific MAP3Ks [34] As a consequence, this docking domain may influence the ability of MKK6 to become phosphorylated in response to various extracellular stressors The role of this docking domain in the requirement of MKK3 or MKK6 to be activated by different MAP3Ks is not known We observed that the corresponding region of the As-MKK6b and c displayed four amino acids that are different from MKK6a Whether the divergence in sequence between the As-MKKs in this region can be explained by selective substrate specificity of MAP3Ks in response to different stress needs further investigation In extracts prepared from TO cells exposed to cellular stress, we found several bands, representing putative phosphorylated MKKs, that cross-reacted with this phospho-antibody Consistent with the results using ectopically expressed MKK6s, the results obtained showed that the response was determined by the extracellular stimuli that were used for activation In sodium arsenite treated TO cells, two bands (approximately 38 kDa and 42 kDa, respectively) showing increased phosphorylation upon activation were detected, whereas, in sorbitol treated cells, only basal phospho-MKK6 levels were detected when using a ultrasensitive substrate The results of a kinase assay using over-expressed MKK6a verified that only sodium arsenite and not sorbitol stimulated its activation in TO cells Despite the inability of sorbitol to induce the phosphorylation of MKK6a in TO cells, phosphorylated p38 was detected in these cells upon both sodium arsenite and sorbitol treatment The results suggest the 4896 existence of yet other MKK ortholog(s) that phosphorylate p38 in sorbitol stimulated TO cells Because p38 phosphorylation was not affected by the SB inhibitor, it is less likely that p38 activation in sorbitol stimulated TO cells is caused by p38 autophosphorylation Interestingly, knockdown of the Drosophila p38 activator D-MKK3 by RNA interference showed a significant, although incomplete, reduction of phosphorylated p38 levels in response to osmotic stress [49], suggesting the existence of another p38 activator in Drosophila By using UV stressed mouse embryonic fibroblast cells lacking both MKK3 and MKK6, it was possible to show that MKK4 participates in the activation of p38 However, the level of activated p38 in these cells was much lower compared to wild-type cells, whereas the level of phosphorylated p38 was not affected in MKK4-single deficient cells [7] This indicates that MKK3 and MKK6 are the main p38 activators, whereas, under certain circumstances, MKK4 participates in the activation of p38 We therefore find it unlikely that MKK4 is the main p38 activator in TO cells stimulated with sorbitol In conclusion, we have identified three upstream activators of p38 in Atlantic salmon, which all appear to be MKK6 orthologs Our phylogenetic analysis strongly indicates that MKK3 is not present in fish The ancestral MKK6 gene appears to have undergone duplication in some fish species and our data demonstrate, for the first time, the existence of three MKK6 copies in any species The results obtained from CHSE-214 cells and TO cells suggest a cell type dependent expression and activation of the salmon MKK6 variants Thus, in a whole organism, expressing these MKK6 genes at different levels may increase the range of possibilities available to fine tune the strength of p38 signaling in specialized cells Experimental procedures Reagents and antibodies Sodium arsenite and sorbitol were obtained from Sigma (St Louis, MO, USA) The p38 inhibitor SB203580 was purchased from Alexis Biochemicals (Lausen, Switzerland) Recombinant ATF-2 and rabbit antibodies against phospho-p38 MAPK, phospho-MKK3 ⁄ 6, phospho-MK2 and eukaryotic elongation factor (eEF2) were obtained from Cell Signaling Technology (Beverly, MA, USA) Rabbit anti-actin serum and mouse anti-GST serum were purchased from Sigma and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively Mouse anti-myc serum was purified from the 9E10 hybridom, and rabbit anti-green fluorescent protein (GFP) was obtained from Abcam (Cam- FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al bridge, MA, USA) Horseradish peroxidase conjugated goat anti-rabbit IgG and goat anti-mouse IgG secondary sera were purchased from Santa Cruz Biotechnology Polyclonal MKK6a, MKK6b and MKK6c antibodies were generated by Eurogentec (Liege, Belgium) using the peptides PPPHQSKGEMSQPKG and SQPKGGKRKPGLKLS from salmon MKK6c sequences The two conjugated peptides were pooled and injected in two rabbits according to Eurogentec’s double XP procedure The resulting antisera were purified by affinity chromatography towards the respective peptides Fish Two-year-old nonvaccinated Atlantic salmon, strain Aquagen standard (Aquagen, Kyrksæterøra, Norway), weighing 350–600 g, was obtained from Tromsø Aquaculture Research Station (Tromsø, Norway) Fish were kept at natural temperature in tanks supplied with running filtered sea water and fed commercial dry feed Atlantic salmon head kidney macrophages were obtained as previously described in [50] and seeded outlined elsewhere [2] Molecular cloning of Atlantic salmon MKKs To obtain a partial cDNA of salmon MKK3 ⁄ 6, we performed RT-PCR cloning using degenerated primers based on conserved regions of human MKK3 (accession number NM_145109) and (GenBank accession number NM_002758), carp MKK6 (GenBank accession number AB023480) and zebrafish MKK3 (GenBank accession number AB030899) A 420 bp PCR product generated using mixed cDNA from ovary and head kidney, obtained as previously described [2], showed the highest identity to MKK3 and MKK6 genes from vertebrate species by a GenBank database blast search The entire ORF of the cDNA was obtained by RACE-PCR using primers designed for the amplification of the 5¢- and 3¢-ends A blast search in the GenBank database with this putative salmon MKK3 ⁄ cDNA identified two rainbow trout (Oncorhynchus mykiss) MKK3 ⁄ EST clones One of the clones showed highest identity to the 5¢-end of salmon MKK3 ⁄ (GenBank accession number CA388006), whereas the other showed the highest identity to the 3¢-end (GenBank accession number CX147893) Primers based on sequences from both EST clones were used to clone another salmon MKK variant A specific primer in the 5¢-UTR of the new MKK was designed and used with the primer MKK6br3¢ The sequence contained a complete ORF of 357 amino acids and was named As-MKK6b The cloning and sequencing of several As-MKK6b clones indicated the existence of another MKK6 variant A part of the 3¢-UTR of the new As-MKK6 variant was amplified and specific primer for the 3¢-UTR of the new As-MKK6 variant was designed and used with the MKK6braf1 primer to amplify the whole Atlantic salmon MKK6 orthologs ORF (359 amino acids) The new As-MKK6 variant was named As-MKK6c All the primers used for cloning As-MKK6a, b and c are listed in Table Sequence and phylogenetic analysis Relevant sequences for a phylogenetic analysis of the MKK3 and MKK6 families were collected MKK3 and MKK6 sequences were fetched from the UniProt database (release 12.6) [51] using blast [52] The obtained sequences included four fish sequences, namely sequences annotated as MKK3 from carp and zebrafish, and two sequences from green pufferfish (Tetraodon nigroviridis) To complement these, relevant fish MKK sequences were fetched from ensembl (release 47) [53] using a profile hidden Markov model built on a multiple sequence alignment of the MKK3 and MKK6 sequences from UniProt Additional relevant sequences were identified in fugu (Takifugu rubripes; two sequences), medaka (Oryzias latipes; two sequences) and stickleback (Gasterosteus aculeatus; one sequence) When isoforms resulting from alternative splicing were encountered, only the longest sequence was retained for further analysis To ensure that no sequences were missed, the procedure was repeated in a greedy fashion, including all seven mammalian MKK sequences and their fish homologues The final set of MKK3 and MKK6 sequences were aligned, and a phylogenetic tree was constructed from the alignment The multiple sequence alignments were constructed using muscle [54], and profile hidden Markov models were generated using the hmmer package (http://hmmer janelia.org) Phylogenetic trees were constructed using mrbayes [55], with the following settings: the prior for the amino acid model was set to mixed, and the number of generations used was 100 000 mrent was used to visualize the trees [56] and texshade was used to present the alignment [57] DNA constructs All As-MKK variants were amplified by PCR using Pfx polymerase (Invitrogen, Carlsbad, CA, USA) and TOPO cloned into the Gateway compatible vector pENTRY using the pENTR ⁄ D-TOPO cloning kit (Invitrogen) following the manufacturer’s protocol Gateway expression clones were made by the Gateway LR Clonase II Enzyme Mix kit with the destination vectors pDEST 27, pDEST 17 (Invitrogen), pDEST-EGFP and pDEST-myc [58], according to the manufacturer’s instruction The As-p38 constructs were made as previously described [2] Mutagenesis of plasmid DNA was performed using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) Various point mutants of all As-MKK6s were generated using the pENTRY constructs and the following complementary primers (only forward primers are shown): As-MKK6b ⁄ cD122A 5¢TGAAGATGTGTGCATTTGGGATCAG-3¢, As-MKK6a FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4897 Atlantic salmon MKK6 orthologs T E Hansen et al Table Primers used for the cloning of As-MKK6a, b and c Name Primer Sequence (5¢- to -3¢) Primer description MKK6adefw3 MKK6aderv2 MKK6adefw2 MKK6aderv3 MKK6arafw1 MKK6ararv1 MKK6arafw2 MKK6ararv2 MKK6aflf MKK6aflr MKK6atoflf MKK6atoflrs MKK6bf3¢ GGNGTGGTGGANAAGATG AAYAANGGATGTTGCAT GTNTGGATHTGCATGGA TCCCCATGANTCATAGG GATCAACACACAGGGCCAGGTGAAGATG GGTCTTGGCCATAGAGTCCACCAGGT GTGGACTCTATGGCCAAGACCA ATCTTCACCTGGCCCTGTGTGT GAATAAGATCTCCACACACCCAGGGC GTTGGAGTTGTGTGGCAGATCAATTC CACCATGTCTCTTTCTAAAGGAGGGAAGAA TCAGTCTGCCAGGATGATCTTGACA GAGAGATTAATCAGAAAGGC MKK6br3¢ MKK6bf5¢ TTGGTCAGAGCGTTGTCTTA CGACCCGTTTCCTGACC MKK6br5¢ MKK6braf1 TGAAGAGTGCGCCGTAGAAGGTGAC AGGTGTGCAATTGTATATTGCTCTTTG MKK6btoflf MKK6btoflr MKK6cf2 CACCATGGAGGGAGGGAGTGAGAAAGAAG TCAGTCCCCGAGGATGACCTT ATCCTGCGGTTTCCCTATGACTCCTGG MKK6cr2 MKK6cUTRr GTAACAGGGTTTGCAATTGG GTTGGGTTAGATAAGGGCGCTCG Degenerated primer based on conserved region of MKK6a Reverse primer for MKK6adefw3 Degenerated nested primer for amplificated MKK6a Reverse primer for MKK6adefw2 RACE primer for MKK6a 3¢-end RACE primer for MK6a 5¢-end Nested primer for RACE 3¢-end products Nested primer for RACE 5¢-end products Primer in 5¢-UTR of MKK6a Primer in 3¢-UTR of MKK6a For topo cloning of MKK6a into pENTR ⁄ D-TOPO Reverse primer for MKK6atoflf Primer based on a part of the 3¢-end to rainbow trout (GenBank accession number CX147893) Reverse primer for MKK6bf3¢ Primer base on a part of the 5¢-end to rainbow trout (GenBank accession number CA388006) Reverse primer for MKK6bf5¢ Primer in 5¢-UTR of MKK6b used with MKK6br3¢ to amplify the MKK6b ORF For topo cloning of MKK6b into pENTR ⁄ D-TOPO Reverse primer for MKK6btoflf Primer specific for MKK6c used with MKK6cr2 to amplify 3¢-UTR of AsMKK6c Reverse primer designed from the EST clone CX147893 Reverse primer specific for MKK6c used with MKK6brafl to amplify the whole ORF of As-MKK6c D199A 5¢-TGAAGATGTGTGCATTTGGCATCAG-3¢, As-MKK6b ⁄ cSE 5¢-GTTACCTGGTGGACGAAGTGGC CAAGACCA-3¢, As-MKK6bTE 5¢-CGAAGTGGCCAAG GAAATAGACGCCGGCTG-3¢, As-MKK6cTE 5¢-CGAA GTGGCCAAGGAAATGGACGCAGGCTG-3¢, As-MKK 6aSE 5¢-GCCACCTGGTGGACGAAGTGGCCAAGACC A-3¢ and As-MKK6aTE 5¢-CGAAGTGGCCAAGGAAA TGGACGCCGGCTG-3¢ All constructs were verified by DNA sequencing using the BigDye sequencing (Applied Biosystems, Foster City, CA, USA) Northern blot analysis RNA isolation and northern blotting protocols have been previously described [2] Briefly, mRNA (2 lg) was resolved on a 1% glyoxal-based agarose gel (Ambion, Austin, TX, USA) and transferred to a nylon membrane by the downward capillary method The membrane was hybridized with 32 P-labeled cDNA probes and two different probes were amplified Template for the As-MKK6a probe was synthesized with primers designed to span the whole ORF (primers MKK6atoflf and MKK6atoflr; Table 1) The template for the MKK6b ⁄ c probe was generated with primers spanning the whole MKK6b ORF (primers MKK6btoflf and MKK6btoflr; Table 1) 4898 RT-PCR For As-MKK6a, b and c expression analysis, we used mRNA isolated as described above and macrophage mRNA was isolated as described previously [2] cDNA synthesis was performed with Superscript III reverse transcriptase (Invitrogen) using random hexamers primers and lg of mRNA in a 20 lL volume The PCR reactions were conducted using Phusion DNA polymerase (Finnzymes Oy, Espoo, Finland) and lL of cDNA The following conditions were applied: As-MKK6a primers (5¢-GGAAGATCACTGTAGCGATC GTCA-3¢ and 5¢-GTTGAGGTCGGGGTTTATCCGT-3¢): 96 °C for 30 min, 35 cycles of 96 °C for 10 s, 67 °C for 15 s and 72 °C extension for 30 s; As-MKK6b primers (5¢-C CGAGGACATACTGGGAAAG-3¢ and 5¢-GTTGTTTTA GATCAGGGCTGCTTA-3¢): 96 °C for 30 min, 30 cycles of 96 °C for 10 s, 65 °C for 15 s and 72 °C extension for 30 s; and, for the As-MKK6c primers (5¢-ATCCTGCGGTTT CCCTATGACTCCTGG-3¢ and 5¢-GTTGGGTTAGATA AGGGCGCTCG-3¢), the conditions same as for the As-MKK6b primers To confirm equal amount of cDNA in the samples, PCR was performed with actin specific primers (5¢-CACTCAACCCCAAAGCCAACAGG-3¢ and 5¢-AAAGTCCAGCGCCACGTAGCACAG-3¢) under the following conditions: 96 °C for 30 min, 20 cycles of 96 °C for 10 s, 68 °C for 20 s and 72 °C for 30 s FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al Cell cultures and transfection Chinook salmon embryonic cells (CHSE-214) were cultured in EMEM (Invitrogen), supplemented with 60 lgỈmL)1 of penicillin, 100 lgỈmL)1 of streptomycin, 1% non-essential amino acids (Invitrogen), mm l-glutamine (Invitrogen) and 7.5% fetal bovine serum (Euroclone, Celbio, Milan, Italy) Cells were grown at 20 °C in a 5% humified CO2 incubator TO cells originate from Atlantic salmon head kidney [59] was obtained from Professor H Wergeland (University of Bergen, Norway) The TO cells were cultured at 20 °C in 5% CO2 in EMEM supplemented with 100 lgỈmL)1 of streptomycin 60 lgỈmL)1 of penicillin, mm l-glutamine, 1% non-essential amino acids and 5% fetal bovine serum Cells for transfection were seeded in culture plates and transfected the next day at 80–90% confluence Transfection of CHSE-214 cells was performed by using Lipofectamine 2000 (Invitrogen) transfection reagent, according to the manufacturer’s instruction TO cells were transfected with FuGENE HD (Roche Diagnostics, Indianapolis, IN, USA) using lg of plasmid and lL of transfection reagents for each 35 mm well Cell lysates for western blotting were harvested in buffer A [20 mm Tris-acetate, pH 7.0; 0.27 m sucrose; mm EDTA; mm EGTA; mm orthovanadate; 10 mm b-glycerophosphate; 50 mm sodium fluoride; mm sodium pyrophosphate; 1% (v ⁄ v) Triton X-100; 0.1% (v ⁄ v) 2-mercaptoethanol and ‘Complete’ protease inhibitor cocktail (one tablet per 50 mL; Roche)] The lysates were centrifuged for 15 at 15 000 g NuPAGE LDS sample buffer (Invitrogen) was added to the lysates and the samples were heated for 10 at 70 °C Western blot analysis Cell lysates were separated by SDS ⁄ PAGE (4–12% precast NuPAGE; Invitrogen), followed by transfer to a 0.45 lm pore size polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA) as described previously [2] and probed with either anti-myc (1 : 500), anti-GST (1 : 500), anti-GFP (1 : 3000), anti-phospho-MKK3 ⁄ (1 : 1000), anti-phosphop38 (1 : 1000) anti-phospho-MK2 (1 : 1000), anti-eEF2 (1 : 1000), anti-pan-MKK6 (1 : 1000) or anti-MKK6b ⁄ c (1 : 1000) sera Detection was performed by using SuperSignal West Pico or West Femto (Pierce Biotechnology, Rockford, IL, USA) p38 kinase assay Transfected cells were washed twice in ice-cold phosphate buffered saline and lysed in 200 lL of ice-cold buffer A with addition of complete protease inhibitor cocktail (one tablet per 50 mL; Roche) The lysate was cleared by centrifugation for 15 at 15 000 g Myc-tagged As-p38 was immunoprecipitated by incubating the lysate at °C for Atlantic salmon MKK6 orthologs h with monoclonal myc antibodies (1 : 20) Then 30 lL of 50% slurry protein G-agarose (Upstate Biotechnology, Lake Placid, NY, USA) pre-equilibrated in buffer A was added and the lysate was incubated for additional h at °C The immunoprecipitated myc-As-p38 was washed three times in ice-cold buffer A and twice in ice-cold kinase buffer (25 mm Hepes, pH 7.4, 25 mm b-glycerophosphate, 25 mm MgCl2, 0.5 mm dithiothreitol, 0.1 mm sodium orthovanadate) The As-p38 kinase activity was measured in 40 lL of kinase buffer containing 0.1 mm ATP (Sigma), lCi [c-32P]ATP (3000 CiỈmmol)1; Amersham Pharmacia, Piscataway, NJ, USA) and lg ATF-2 (Cell Signaling) at 30 °C The reaction was terminated after 30 by adding 14 lL of 4· LDS-sample buffer The incorporation of radioactive phosphate into ATF-2 was examined after SDS ⁄ PAGE by autoradiography Immunoprecipitation of myc-tagged and endogenous MKKs Cells transfected with myc-MKK6a, b and c were lysed as described in the kinase assay part above Myc-MKKs were immunoprecipitated by incubation the cleared lysate at °C for h with monoclonal myc antibodies (1 : 20), before addition of 30 lL of protein G-agarose (50% slurry pre-equilibrated in buffer A) and incubated at °C for h The immunoprecipitated myc-MKKs were washed three times in ice-cold buffer A and twice in ice-cold kinase buffer Immunoprecipitates not used for kinase assays were washed three times in buffer A and resuspended in 40 lL of 2· LDS-sample buffer TO cells seeded in 35 mm wells were lysed in 200 lL of buffer A with complete protease inhibitor cocktail and identical samples from two wells were pooled together Lysates were cleared by centrifugation at °C for 15 at 15 000 g Endogenous MKK was immunoprecipitated by incubating the cleared lysate at °C for h with polyclonal pan-As-MKK6 peptide antibody (1 : 40) Then 30 lL of 50% slurry pre-blocked protein A ⁄ G PLUS-agarose (Santa Cruz) pre-equilibrated in buffer A was added and incubated at °C for h The immunoprecipitated MKKs were washed three times in ice-cold buffer A and twice in ice-cold kinase buffer The kinase activity of immunoprecipitated myc-MKKs and endogenous MKKs were measured in 40 lL of kinase buffer containing 200 lm ATP and lg As-p38a at 14 °C The reaction was terminated after 30 by adding 14 lL of 4· LDS-sample buffer The phosphorylation of recombinant As-p38a was examined by SDS ⁄ PAGE and detected by anti-phospho-p38 serum Expression of His-p38a in Escherichia coli His-tagged full-length p38a was expressed in Escherichia coli (BL21[DE3]pLysS) by induction with lm isopropyl-1- FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4899 Atlantic salmon MKK6 orthologs T E Hansen et al thio-b-d-galactopyranoside at 23 °C for h His-p38a was then purified on a HisTrap HP column (Amersham Pharmacia) using standard techniques Expression and purity of this fusion protein were checked by SDS ⁄ PAGE (4–12% precast NuPAGE; Invitrogen) and Coomassie blue staining Protein concentration was measured by the Bradford protein assay (Bio-Rad, Hercules, CA, USA) Acknowledgements 10 11 12 We thank Dr A N Larsen (University of Tromsø) for assisting in the purifying of recombinant As-p38a This work was supported by a grant from the Research Council of Norway (NFR 154197 ⁄ 432) The Norwegian Structural Biology Centre (NorStruct) is supported by the National program in Functional Genomics (FUGE) in the Research Council of Norway O M Seternes is a fellow of the Norwegian Cancer Society 13 14 15 References Raingeaud J, Gupta S, Rogers JS, Dickens M, Han J, Ulevitch RJ & Davis RJ (1995) Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine J Biol Chem 270, 7420–7426 Hansen TE & Jørgensen JB (2007) Cloning and characterisation of p38 MAP kinase from Atlantic salmon A kinase important for regulating salmon TNF-2 and IL1beta expression Mol Immunol 44, 3137–3146 Anderson NG, Maller JL, Tonks NK & Sturgill TW (1990) Requirement for integration of signals from two distinct phosphorylation pathways for activation of MAP kinase Nature 343, 651–653 Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M & Davis RJ (1994) JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain Cell 76, 1025–1037 Cuevas BD, Abell AN & Johnson GL (2007) Role of mitogen-activated protein kinase kinase kinases in signal integration Oncogene 26, 3159–3171 Zarubin T & Han J (2005) Activation and signaling of the p38 MAP kinase pathway Cell Res 15, 11–18 Brancho D, Tanaka N, Jaeschke A, Ventura JJ, Kelkar N, Tanaka Y, Kyuuma M, Takeshita T, Flavell RA & Davis RJ (2003) Mechanism of p38 MAP kinase activation in vivo Genes Dev 17, 1969–1978 Enslen H, Brancho DM & Davis RJ (2000) Molecular determinants that mediate selective activation of p38 MAP kinase isoforms EMBO J 19, 1301–1311 Ho DT, Bardwell AJ, Grewal S, Iverson C & Bardwell L (2006) Interacting JNK-docking sites in MKK7 4900 16 17 18 19 20 21 promote binding and activation of JNK mitogen-activated protein kinases J Biol Chem 281, 13169–13179 Enslen H & Davis RJ (2001) Regulation of MAP kinases by docking domains Biol Cell 93, 5–14 Ho DT, Bardwell AJ, Abdollahi M & Bardwell L (2003) A docking site in MKK4 mediates high affinity binding to JNK MAPKs and competes with similar docking sites in JNK substrates J Biol Chem 278, 32662–32672 Xu B, Stippec S, Robinson FL & Cobb MH (2001) Hydrophobic as well as charged residues in both MEK1 and ERK2 are important for their proper docking J Biol Chem 276, 26509–26515 Derijard B, Raingeaud J, Barrett T, Wu IH, Han J, Ulevitch RJ & Davis RJ (1995) Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms Science 267, 682–685 Han J, Wang X, Jiang Y, Ulevitch RJ & Lin S (1997) Identification and characterization of a predominant isoform of human MKK3 FEBS Lett 403, 19–22 Moriguchi T, Kuroyanagi N, Yamaguchi K, Gotoh Y, Irie K, Kano T, Shirakabe K, Muro Y, Shibuya H, Matsumoto K et al (1996) A novel kinase cascade mediated by mitogen-activated protein kinase kinase and MKK3 J Biol Chem 271, 13675–13679 Han J, Lee JD, Jiang Y, Li Z, Feng L & Ulevitch RJ (1996) Characterization of the structure and function of a novel MAP kinase kinase (MKK6) J Biol Chem 271, 2886–2891 Cuenda A, Alonso G, Morrice N, Jones M, Meier R, Cohen P & Nebreda AR (1996) Purification and cDNA cloning of SAPKK3, the major activator of RK ⁄ p38 in stress- and cytokine-stimulated monocytes and epithelial cells EMBO J 15, 4156–4164 Moriguchi T, Toyoshima F, Gotoh Y, Iwamatsu A, Irie K, Mori E, Kuroyanagi N, Hagiwara M, Matsumoto K & Nishida E (1996) Purification and identification of a major activator for p38 from osmotically shocked cells Activation of mitogen-activated protein kinase kinase by osmotic shock, tumor necrosis factor-alpha, and H2O2 J Biol Chem 271, 26981–26988 Jiang Y, Gram H, Zhao M, New L, Gu J, Feng L, Di Padova F, Ulevitch RJ & Han J (1997) Characterization of the structure and function of the fourth member of p38 group mitogen-activated protein kinases, p38delta J Biol Chem 272, 30122–30128 Enslen H, Raingeaud J & Davis RJ (1998) Selective activation of p38 mitogen-activated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6 J Biol Chem 273, 1741–1748 Jiang Y, Chen C, Li Z, Guo W, Gegner JA, Lin S & Han J (1996) Characterization of the structure and function of a new mitogen-activated protein kinase (p38beta) J Biol Chem 271, 17920–17926 FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS T E Hansen et al 22 Cuenda A, Cohen P, Buee-Scherrer V & Goedert M (1997) Activation of stress-activated protein kinase-3 (SAPK3) by cytokines and cellular stresses is mediated via SAPKK3 (MKK6); comparison of the specificities of SAPK3 and SAPK2 (RK ⁄ p38) EMBO J 16, 295– 305 23 Goedert M, Cuenda A, Craxton M, Jakes R & Cohen P (1997) Activation of the novel stress-activated protein kinase SAPK4 by cytokines and cellular stresses is mediated by SKK3 (MKK6); comparison of its substrate specificity with that of other SAP kinases EMBO J 16, 3563–3571 24 Lu HT, Yang DD, Wysk M, Gatti E, Mellman I, Davis RJ & Flavell RA (1999) Defective IL-12 production in mitogen-activated protein (MAP) kinase kinase (Mkk3)-deficient mice EMBO J 18, 1845–1857 25 Wysk M, Yang DD, Lu HT, Flavell RA & Davis RJ (1999) Requirement of mitogen-activated protein kinase kinase (MKK3) for tumor necrosis factor-induced cytokine expression Proc Natl Acad Sci USA 96, 3763– 3768 26 Tanaka N, Kamanaka M, Enslen H, Dong C, Wysk M, Davis RJ & Flavell RA (2002) Differential involvement of p38 mitogen-activated protein kinase kinases MKK3 and MKK6 in T-cell apoptosis EMBO Rep 3, 785–791 27 Fujii R, Yamashita S, Hibi M & Hirano T (2000) Asymmetric p38 activation in zebrafish: its possible role in symmetric and synchronous cleavage J Cell Biol 150, 1335–1348 28 Han J, Lee JD, Bibbs L & Ulevitch RJ (1994) A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells Science 265, 808–811 29 Hashimoto H, Fukuda M, Matsuo Y, Yokoyama Y, Nishida E, Toyohara H & Sakaguchi M (2000) Identification of a nuclear export signal in MKK6, an activator of the carp p38 mitogen-activated protein kinases Eur J Biochem 267, 4362–4371 30 Kumar S, McDonnell PC, Gum RJ, Hand AT, Lee JC & Young PR (1997) Novel homologues of CSBP ⁄ p38 MAP kinase: activation, substrate specificity and sensitivity to inhibition by pyridinyl imidazoles Biochem Biophys Res Commun 235, 533–538 31 Mertens S, Craxton M & Goedert M (1996) SAP kinase-3, a new member of the family of mammalian stress-activated protein kinases FEBS Lett 383, 273– 276 32 Han ZS, Enslen H, Hu X, Meng X, Wu IH, Barrett T, Davis RJ & Ip YT (1998) A conserved p38 mitogenactivated protein kinase pathway regulates Drosophila immunity gene expression Mol Cell Biol 18, 3527–3539 33 Brewster JL, de Valoir T, Dwyer ND, Winter E & Gustin MC (1993) An osmosensing signal transduction pathway in yeast Science 259, 1760–1763 34 Takekawa M, Tatebayashi K & Saito H (2005) Conserved docking site is essential for activation of Atlantic salmon MKK6 orthologs 35 36 37 38 39 40 41 42 43 44 45 46 mammalian MAP kinase kinases by specific MAP kinase kinase kinases Mol Cell 18, 295–306 Winter-Vann AM & Johnson GL (2007) Integrated activation of MAP3Ks balances cell fate in response to stress J Cell Biochem 102, 848–858 Rouse J, Cohen P, Trigon S, Morange M, AlonsoLlamazares A, Zamanillo D, Hunt T & Nebreda AR (1994) A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins Cell 78, 1027–1037 Barchowsky A, Dudek EJ, Treadwell MD & Wetterhahn KE (1996) Arsenic induces oxidant stress and NF-kappa B activation in cultured aortic endothelial cells Free Radic Biol Med 21, 783–790 Liu Y, Guyton KZ, Gorospe M, Xu Q, Lee JC & Holbrook NJ (1996) Differential activation of ERK, JNK ⁄ SAPK and P38 ⁄ CSBP ⁄ RK map kinase family members during the cellular response to arsenite Free Radic Biol Med 21, 771–781 Uhlik MT, Abell AN, Johnson NL, Sun W, Cuevas BD, Lobel-Rice KE, Horne EA, Dell’Acqua ML & Johnson GL (2003) Rac-MEKK3-MKK3 scaffolding for p38 MAPK activation during hyperosmotic shock Nat Cell Biol 5, 1104–1110 Salvador JM, Mittelstadt PR, Guszczynski T, Copeland TD, Yamaguchi H, Appella E, Fornace AJ Jr & Ashwell JD (2005) Alternative p38 activation pathway mediated by T cell receptor-proximal tyrosine kinases Nat Immunol 6, 390–395 Ge B, Gram H, Di Padova F, Huang B, New L, Ulevitch RJ, Luo Y & Han J (2002) MAPKK-independent activation of p38alpha mediated by TAB1-dependent autophosphorylation of p38alpha Science 295, 1291–1294 Tong L, Pav S, White DM, Rogers S, Crane KM, Cywin CL, Brown ML & Pargellis CA (1997) A highly specific inhibitor of human p38 MAP kinase binds in the ATP pocket Nat Struct Biol 4, 311–316 Raingeaud J, Whitmarsh AJ, Barrett T, Derijard B & Davis RJ (1996) MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway Mol Cell Biol 16, 1247–1255 Dhillon AS & Kolch W (2004) Oncogenic B-Raf mutations: crystal clear at last Cancer Cell 5, 303–304 Tanaka-Hino M, Sagasti A, Hisamoto N, Kawasaki M, Nakano S, Ninomiya-Tsuji J, Bargmann CI & Matsumoto K (2002) SEK-1 MAPKK mediates Ca2+ signaling to determine neuronal asymmetric development in Caenorhabditis elegans EMBO Rep 3, 56–62 Allendorf FW & Thorgaard GH (1984) Tetraploidy and the evolution of salmonid fishes In: Evolutionary Genetics of Fishes (Turner BJ, ed.), pp 1–53 Plenum, New York, NY FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS 4901 Atlantic salmon MKK6 orthologs T E Hansen et al 47 Krens SF, He S, Spaink HP & Snaar-Jagalska BE (2006) Characterization and expression patterns of the MAPK family in zebrafish Gene Expr Patterns 6, 1019–1026 48 Li Y, Batra S, Sassano A, Majchrzak B, Levy DE, Gaestel M, Fish EN, Davis RJ & Platanias LC (2005) Activation of mitogen-activated protein kinase kinase (MKK) and MKK6 by type I interferons J Biol Chem 280, 10001–10010 49 Zhuang ZH, Zhou Y, Yu MC, Silverman N & Ge BX (2006) Regulation of Drosophila p38 activation by specific MAP2 kinase and MAP3 kinase in response to different stimuli Cell Signal 18, 441–448 50 Jørgensen JB & Robertsen B (1995) Yeast beta-glucan stimulates respiratory burst activity of Atlantic salmon (Salmo salar L.) macrophages Dev Comp Immunol 19, 43–57 51 The_UniProt_Consortium (2007) The universal protein resource (UniProt) Nucleic Acids Res 35, D193–D197 52 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res 25, 3389–3402 53 Flicek P, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y, Clarke L, Coates G, Cunningham F, Cutts T 4902 54 55 56 57 58 59 et al (2007) Ensembl 2008 Nucleic Acids Res 36, D707–D714 Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput Nucleic Acids Res 32, 1792–1797 Ronquist F & Huelsenbeck JP (2003) mrbayes 3: Bayesian phylogenetic inference under mixed models Bioinformatics 19, 1572–1574 Zuccon A & Zuccon D (2006) MrEnt v1.2 (Program Distributed by the Authors) Department of Vertebrate Zoology & Molecular Systematics Laboratory, Swedish Museum of Natural History, Stockholm Beitz E (2000) TEXshade: shading and labeling of multiple sequence alignments using LATEX2 epsilon Bioinformatics 16, 135–139 Lamark T, Perander M, Outzen H, Kristiansen K, Overvatn A, Michaelsen E, Bjorkoy G & Johansen T (2003) Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins J Biol Chem 278, 34568–34581 Wergeland HI & Jakobsen RA (2001) A salmonid cell line (TO) for production of infectious salmon anaemia virus (ISAV) Dis Aquat Organ 44, 183–190 FEBS Journal 275 (2008) 4887–4902 ª 2008 The Authors Journal compilation ª 2008 FEBS ... Moriguchi T, Kuroyanagi N, Yamaguchi K, Gotoh Y, Irie K, Kano T, Shirakabe K, Muro Y, Shibuya H, Matsumoto K et al (19 96) A novel kinase cascade mediated by mitogen- activated protein kinase kinase and... and 6a A B Ectopically expressed As-MKK6a, b and c are differently activated by diverse types of stress The p38 signalling cascade is activated by diverse classes of stress [1,28, 36] To explore... Hashimoto H, Fukuda M, Matsuo Y, Yokoyama Y, Nishida E, Toyohara H & Sakaguchi M (2000) Identification of a nuclear export signal in MKK6, an activator of the carp p38 mitogen- activated protein kinases