r cg timer user c line 59 approx and put a break in the following line of code
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
... chains act on the bracket such that they create a resultant force having magnitude F R If two of the chains are subjected to known forces, as shown, determine the orientation θ of the third chain,measured ... two chains If the resultant force is to be F, directed along the positive y axis, determine the magnitudes of forces FA and F B acting on each chain and the orientation θ of F B so that the magnitude ... Inc., Upper Saddle River, NJ All rights reserved This material is protected under all copyright laws as they currently exist No portion of this material may be reproduced, in any form or by any...
- 1,119
- 1,071
- 2
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... [12] Characterization of eEF 1A in normal and cancer cells In order to compare the binding properties of the nuclear eEF 1A in normal cells compared with those in cancer CCRF-CEM cells, human lymphocytes ... showed, in T-lymphoblastic CCRF-CEM cancer Fig Bidimensional PAGE analysis of nuclear elongation factor alpha (eEF 1A) (A) Thirty micrograms of nuclear extracts from CCRF CEM cells and normal human ... Differential screening of a human pancreatic adenocarcinoma lambda gt11 expression library has identified increased transcription of elongation factor EF-1 alpha in tumour cells Int J Cancer 50,...
- 12
- 552
- 0
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
... temperature-induced structural changes in the Raman spectra during premelting are mainly characterized, in SVD analysis, by variation in the V2 contribution of the spectral component S2 Actually, ... linear Accelerator Laboratory (Orsay, France) for running Super ACO References Minty A & Kedes L (1986) Upstream regions of the human cardiac actin gene that modulate its transcription in muscle ... shift values were corrected by using an automatic recalibration procedure Subtle changes in Raman spectra were visualized by calculating difference spectra When spectra of particular duplexes were...
- 16
- 538
- 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting ... Fermentas) and 10 lm of each of the following primers For NKA8: forward, 5¢-GTCTCCAGACGTCTCGAAC-3¢; reverse, 5¢-CATCCAAGTCTTGGGAGCTC-3¢ For NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC-3¢; reverse, ... 5¢-CACGATGATGGATGAAATGGCG TC-3¢ For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢ Cycling conditions were 94 C for min, followed by 35 cycles of 94 °C...
- 10
- 639
- 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... space and caveolae lacking access from the cell surface Closed caveolae have restricted access through caveolae openings, and the presence of a ‘diaphragm’ over some caveolae openings has indeed ... after discontinuous sucrose gradient centrifugation of a carbonate extract of rat adipocyte plasma membranes [20] VHD-caveolae lack cell surface access The biotin labelling of cell surface proteins ... plasma membrane We now report the separation and biochemical characterization of three classes of caveolae, which demonstrate a segregation of functions in caveolae subclasses Results Primary rat...
- 12
- 460
- 0
Future R&D Environments A Report for the National Institute of Standards and Technology potx
... science and technology and the factors that affect them, uncertainty about the future remains very high Uncertainty is inherent in the nature and timing of research advances and technological ... and treatment Macromolecule Microarrays Macromolecule microarrays, or biochips, are surfaces, usually of a size comparable to a microscope slide, to which an array of extremely small clusters of ... improved processing and superior mechanical properties of the organic material with the unique functional characteristics of the inorganic material to form the hybrid material Semiconductor applications...
- 233
- 408
- 0
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx
... basal levels and reached a maximum of approximately threefold increase at 100 nM PMA In contrast SYDe showed a slight and not significant increase in sAPPa release at all concentrations of PMA ... downregulation of PKCe and/ or PKCa to understand the respective roles of these speci c isoforms of PKC in the activation of APP proteolytic processing Materials and methods Materials All culture media, supplements ... MAP-kinase following carbachol treatment is consistent with the presence of a redundant signalling pathway downstream of the cholinergic receptor In addition, the fact that sAPPa release following...
- 8
- 458
- 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... coexpression of the C- terminal, cytosolic domain of c- 2 (c -2, C- terminal 59 amino acids) with a- 2 or C- terminal deletion mutants of a- 2 PCR products comprising the appropriate DNA fragments were obtained ... Dahinden et al oad-2 genes are part of the citrate fermentation operon and accordingly, the oad-2 genes are expressed during anaerobic growth of V cholerae on citrate (data not shown) The catalytic ... between a- 2 and the c -2 mutants, the C- terminal part of a- 2 (a- 2 -C) was synthesized together with c -2 and mutants thereof in E coli The construct of a- 2 -C covers the 151 C- terminal residues of a- 2...
- 10
- 333
- 0
Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx
... 5¢-CTGGAGACTTCCGATGGAGA-3¢ and rVRL-1–56 8R: 5¢-CATCCGCTCCATTCTCTACC-3¢ to obtain fragment A with 534 bp; rVRL-1–549F: 5¢-GGTAGAGAATGGAGCGGATG-3¢ and rVRL-1– 120 5R: 5¢-ACCAAGTAGCAGGCGAAGTT-3¢ to obtain fragment B ... vanilloid receptor like-protein (rVRL-1) was cloned from total rat brain cDNA Reverse-transcription polymerase chain reaction (RT-PCR) was carried out with speci c rVRL-1 forward and reverse primers ... preparation from the electric organ of Torpedo californica containing mainly nicotinic acetylcholine receptor (nAChR) was used as a positive control After incubation the probes were separated...
- 8
- 439
- 0
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
... valinomycin and nigericin were added at 10 lM to collapse the transmembrane proton gradient and to avoid spectral interference due to BChl and carotenoid electrochromic effects; lM antimycin A ... F-statistic to determine the probability p of a particular fractional increase in v2 according to: generally asymmetrical, due to the nonlinear nature of deconvolution RESULTS Construction of the PufX ... that are maintained in a spatial orientation that maximizes the efficiency of the energy transfer reactions Structures of the LH2 [3,4] and RC [5], as well as of cyt bc1 [6] are known at atomic...
- 9
- 547
- 0
Báo cáo hóa học: " Discovery of significant variants containing large deletions in the 5''''UTR of human hepatitis C virus (HCV)" pot
... development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community ... CA, Drs Rosemary McIntyre and Parsa of Hematology & Oncology Specialists of Oxnard, Ventura, CA, and the staff of Hematology & Oncology Specialists, Ventura, CA for their continued efforts and ... Plasma from patient 313 contains the extra C, which could cause the HCV RNA polymerase to accidentally create the deleted versions of the 5'UTR However, of our isolates containing the extra C' s,...
- 5
- 276
- 0
Designation: C 51 – 00a - Lime and Limestone (as used by the Industry)1 pptx
... logarithm of the hydrogen ion concentration, which can be greatly affected by temperature, particularly under alkaline conditions It is therefore important to measure alkaline earth solutions (AES) ... combination may be produced either primarily or as a by-product of materials other than limestone, for example, Ca(OH)2 formed by acetylene generation from calcium carbide (CaC2), water treatment sludges, ... with water hydraulic hydrated lime the hydrated dry cementitious product obtained by calcining a limestone containing silica and alumina to a temperature short of incipient fusion so as to form...
- 3
- 353
- 0
Designation: C 226 – 96 - Air-Entraining Additions for Use in the Manufacture pot
... length at days of age Concrete Mixtures 8.1 Preparation and Weighing—Prepare all materials used in preparing the concrete mixtures, and make all weighings, as prescribed in Practice C 192 Report the ... for the remainder of the test period Obtain a length comparator reading for each specimen at 28 days, 180 days, and 365 days of total age Report the length change for each bar as a percentage of ... greater than that of similar mortar bars made with the corresponding “control” cement and similarly tested 4.4.5 The percentage of air entrained in the concrete made with cement containing the...
- 4
- 367
- 0
Báo cáo khoa học: "Increased phosphorylation of c-Jun NH (2)-terminal protein kinase in the sciatic nerves of Lewis rats with experimental autoimmune neuritis" ppt
... n( yad gnihctam hcae ta star lortnoc dezinummi-AFC morf deniatbo erew sevren citaics ehT )0 .R ,sisylarap bmildnih fo yrevocer retfa( 03 dna ,)1 .R ,sisylarap bmildnih fo yrevocer laitrap retfa( ... esuom ro ,)kramneD ,okaD( 001S-itna lanolcylop tibbar ,)ASU ,gnilangiS lleC( KNJ-p-itna lanolcylop tibbar htiw tcaer ot dewolla dna deziniffarap-ed erew star detceffa-NAE dna lortnoc morf sevren citaics ... morf stluser eht fi ,eroferehT ]1[ sisylarap morf derevocer star NAE eht retfa neve evren citaics eht ni deniamer noitalyrohpsohp desaercni eht dna ,egats ylrae eht ta NAE htiw sevren citaics eht...
- 5
- 206
- 0
Báo cáo toán học: "A Note on the Critical Group of a Line Graph" doc
... Berget, Andrew Manion, Molly Maxwell, Aaron Potechin, and Victor Reiner The critical group of a line graph arxiv:math.CO/0904.1246 [2] Alexander E Holroyd, Lionel Levine, Karola M´sz´ros, Yuval Peres, ... 2008 [3] Lionel Levine Sandpile groups and spanning trees of directed line graphs Journal of Combinatorial Theory, Series A, 118:350–364, 2011 the electronic journal of combinatorics 18 (2011), #P124 ... subgraph containing all of the vertices of G, having no directed cycles, and for which w∗ has outdegree and every other vertex has out-degree Let κ(G, w∗ ) denote the number of directed spanning...
- 6
- 320
- 0
Báo cáo y học: "Myeloid dendritic cells display downregulation of C-type lectin receptors and aberrant lectin uptake in systemic lupus erythematosus" pdf
... phenotype, characterized by accelerated differentiation, increased baseline maturation, augmented synthesis of proinflammatory cytokines, and increased ability to promote increased proliferation and activation ... significant clinical overlap with Available online http://arthritis-research.com/content/10/5 /R1 14 Table Demographic and clinical characteristics of systemic lupus erythematosus patients Characteristic ... software Stained cells were gated by side-scatter and forward-scatter characteristics and were further identified by surface markers The results were expressed as the percentage of cells staining...
- 10
- 327
- 0
báo cáo khoa học: " Seroprevalence of HIV, hepatitis b, and hepatitis c among opioid drug users on methadone treatment in the netherlands" ppt
... establish routine screening programs for HIV, HBV and HCV among ODUs in methadone care in the Netherlands Expanding annual screening programs and strengthening coverage will enable improved care for ... care, it is of importance to raise awareness about HCV and facilitate its early diagnosis among incarcerated drug users and others outside the methadone setting Harm reduction interventions and ... methadone programs are primarily intended for harm reduction rather than drug rehabilitation [14] A total of 11 institutions for care and treatment of drug users control the management of 85 methadone...
- 7
- 340
- 0
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
... well-established clinical research infrastructure, which aids the introduction of new interventions, increasing compliance from staff and users Indeed, the development and fostering of a culture of research ... first covariate to control for initial individual differences, and baseline score on the injecting subscale of the HIV Risk-Taking Behaviour Scale as the second covariate where appropriate, as ... brain damage or mental impairment The inclusion and exclusion criteria were established by a combination of clinical assessment by service staff, and baseline research interview conducted by the...
- 12
- 454
- 0
Anticipated user experience in the early stages of product development
... chapter, the AUX Framework is introduced and discussed Further, the characteristics of anticipated and real user experiences are compared and differentiated 12 Chapter 1: Introduction Chapter ... instrumental aspects of user- product interaction Second, they agree that user experience approaches the analysis of user- product interaction holistically, taking into account all aspects that can ... responses resulting from interactions or anticipated interactions Before, during, and after interaction Sward and M acarthur The value derived from interaction(s) [or anticipated interaction(s)]...
- 311
- 379
- 0
DSpace at VNU: Holding the line: family responses to pregnancy and the desire for a child in the context of HIV in Vietnam
... social criteria including a maximum of two children, abstaining from quarrels and from drugs Wards with high concentrations of these ‘cultural’ families are praised HIV, lineage and pregnancy in ... influenced Vietnamese culture, sons make the ancestral sacrifices, pray to the ancestors and carry on the family line; failure to have children, especially a son, is a disgrace to the ancestors and ... lineage and pregnancy in Vietnam 405 concerned about continuing the lineage Anti-retroviral therapy is increasingly available in Vietnam Studies in other countries on the fertility desires of infected...
- 16
- 191
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25