quot internal quot analysis of incidence ratio ratios for communities with a medium or large area under cultivation in comparison with communities with a small area under cultivation
Báo cáo khoa học: "Hospitalized cancer patients with severe sepsis: analysis of incidence, mortality, and associated costs of care" doc
... complications of cancer and cancer treatment Pediatr Clin North Am 2003, 32:613-624 State of Florida: Agency for Health Care Administration Hospital Inpatient Data File 1999 The Commonwealth of Massachusetts: ... (Microsoft® Corporation, Redmond, WA, USA), and conducted analyses in Data Desk® (Data Description Inc., Ithaca, NY, USA) and in SAS® (SAS Institute Inc., Cary, NC, USA) Results Incidence Of the ... 1999 State of New York: State of New York Department of Health SPARCS: 'Expanded Administrative Releasable' Data 1999 State of Virginia: Virginia Health Information Public use filePUF1 Patient...
- 8
- 233
- 0
River Water Quality Analysis of Hadano Basin and its Relationship with Nonpoint Sources of Pollution
... population (person), agriculture area (m2), urban area (m2) and forest area (m2) In the case of agriculture area, as it contains paddy field and cultivated land, the total area was calculated as an ... respective drainage basins were taken as explanatory variables In the case of agriculture area, as in the simple regression analysis, the total area was calculated as an equivalent area based on the ... No.2, 2011 Land use data of each drainage basin was extracted in GIS and the area of each land use type was calculated (Fig 6).Building data with floor area were also acquired from Kanagawa Prefecture...
- 28
- 593
- 0
A Meta-Analysis of Fear Appeals: Implications for Effective Public Health Campaigns pdf
... successes and failures of fear appeals, and fear is reincorporated as a central variable in the model According to the EPPM, the evaluation of a fear appeal initiates two appraisals of the message, ... messages Ninety-eight studies met the criteria for inclusion in the meta -analysis (All coding information for the main effects and the interaction effects for each study are available from the authors ... that cited fear appeal work, used traditional fear appeal methods and measures, and varied the level of either fear or threat in a message were retained for analysis To be included in this meta -analysis, ...
- 25
- 486
- 0
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... function for two or more groups display DIF In the case of determining cut points for passing a subtest, as is the case for the MEAMS, a formal test of the validity of the cut point is the absence of ... necessitated by another factor which has also been Table 5: Final pass scores of MEAMS, adjusted for age and educational level for use in Turkey Subtest Orientation Name Learning Naming Comprehension ... hospital staff, relatives of hospital staff and relatives of patients All participants gave informed consent Potential subjects for MEAMS administration were questioned regarding their health status...
- 8
- 448
- 0
Báo cáo hóa học: " BER analysis of TDD downlink multiuser MIMO systems with imperfect channel state information" pot
... pre-processing SNR of downlink data symbol Note that all data streams to the same user have the same SINR because we not consider the power allocation strategy for all data streams and each data stream ... obtain a closed-form expression for (22), the integral is fairly straightforward to evaluate numerically, at least when min(M, N) is small (in practical communication systems, the number of antennas ... causes array gain loss while CSI delay causes diversity gain loss At high SNR, CSI delay causes more performance degradation than channel estimation error Especially, our research is valuable for...
- 9
- 373
- 0
Báo cáo hóa học: " Research Article Design and Performance Analysis of an Adaptive Receiver for Multicarrier DS-CDMA" doc
... algorithms are able to function properly are investigated Secondly, instead of simply implementing a heuristic algorithm, we perform a thorough analysis on the system performance and obtain a ... frequency-selective Rayleigh fading channel with a delay spread of Tm Since the spread spectrum system can resolve multipath signals with delay larger than one chip duration, for an SC-DS-CDMA system with a chip ... data, Tb is the transmission interval for each block of data, pτ (t) is defined as the rectangular pulse waveform with unit amplitude and duration τ, ωq and φq are the frequency and random phase...
- 10
- 436
- 0
Báo cáo hóa học: " Research Article Time-Frequency Analysis of Heart Rate Variability for Neonatal Seizure Detection" pdf
... fluctuations instantaneously HRV computation The time series of RR interval is called tachogram Errors in peak detection are corrected based on timing analysis rather than amplitude analysis Missing ... encountered in frequency-domain processing is the nonstationary behavior of heart beats Even for a normal healthy person, the heart beats tend to be timevariant This is because the interbeat interval of ... Burke and Ms Jane Richmond from the Royal Children’s Hospital in Brisbane, Australia for their assistance for the labeling and interpretation of the EEG data used in this study M B Malarvili et al...
- 10
- 322
- 0
Báo cáo nghiên cứu khoa học: "FINITE ELEMENT ANALYSIS OF ELASTO-PLASTIC BOUNDARY FOR SOME STRUCTURE PROBLEMS" pot
... 40 Displacement U (mm) Fig Uniform load – displacement curves for meshes M2, M4 and M5 Table2 Comparison of displacement at mid-point of the beam with formulation of shear stiffness matrix [Ks] ... 2.2 Elasto-plastic Timoshenko beam analysis 2.2.1.Timoshenko beam theory This theory allows for transverse shear deformation effects while Euler-Bernoulli beam theory takes no account of transverse ... each element having differential stiffness matrix is especially adaptive for analyzing some thick-walled pipes structures made by composite material! Elements containing differential material...
- 8
- 471
- 0
Báo cáo khoa học: "Validity of leaf areas and angles estimated in a beech forest from analysis of gap frequencies, using hemispherical photographs and a plant canopy analyzer" pot
... estimating forest leaf area, Agric For Meteorol 57 (1991) 107-128 [5] Chen J.M., Optically-based methods for measuring seasonal variation of leaf area index in boreal conifer stands, Agric For Meteorol ... takes into ) 90 account a large part of the variability in azimuth of the gap fraction A sharper analysis (K and K leads to a ) 22 45 smaller but non-negligible increase in K 3.4 Leaf area index ... error in the theoretical case of composed of leaves having all the same inclina- canopy tion For α ranging from to 90°, the function G(α, 0) was calculated for the &thetas; angles corresponding...
- 10
- 384
- 0
Báo cáo khoa học: "Analysis of clinical and dosimetric factors associated with severe acute radiation pneumonitis in patients with locally advanced non-small cell lung cancer treated with concurrent chemotherapy and intensity-modulated radiotherapy" pot
... to a large volume of lung could be much worse than a large dose to a small volume in functional lung damage So we think that the lung received a small dose of radiation as low as 10 Gy to a large ... the study and performed the statistical analysis and drafted the manuscript HW, RY, FL and BX participated in acquisition of data All authors read and approved the final manuscript Acknowledgements ... radiochemotherapy with vinorelbine plus cisplatin or carboplatin in patients with locally advanced non -small- cell lung cancer (NSCLC) and an increased risk of treatment complications: Preliminary...
- 8
- 371
- 0
báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx
... utilization of informatics system by providers and patients 161 Decision support 131 Collaborative care and informatics 129 Health information and data 126 Positives 98 Negatives 68 Barriers to informatics ... informatics quotations did not generally integrate well with findings from the other codes, and thus would not have been appropriate for incorporation into other publications (although some individual ... Mental Health Social Worker Non-clinical administrator Medical center or regional network manager Care managers (RNs specializing in depression disease management) 19 Bonner et al Implementation...
- 8
- 249
- 0
Báo cáo y học: " A meta-analysis of gemcitabine containing chemotherapy for locally advanced and metastatic pancreatic adenocarcinoma" ppsx
... gemcitabine alone or in combination with capecitabine in patients with metastatic pancreatic adenocarcinoma: a randomized phase II trial Ann Oncol 2003, 14:97-104 Berlin JD, Catalano P, Thomas JP, ... E, Taùeb J, Faroux R, Lepere C, de Gramont A, GERCOR and GISCAD: Gemcitabine in combination with oxaliplatin compared with gemcitabine alone in locally advanced or metastatic pancreatic cancer: ... Page 10 of 15 Figure Comparison of gemcitabine plus platinum combination with gemcitabine alone A, gemcitabine/platinum versus gemcitabine alone on 1-year survival; B, gemcitabine/oxaliplatin...
- 15
- 380
- 0
Báo cáo y học: "Analysis of host- and strain-dependent cell death responses during infectious salmon anemia virus infection in vitro" doc
... listed in table S1 in Additional file Statistical analysis Statistical analysis was performed using the SPSS and Sigma Stat programs A P value of < 0.05 was considered significant Competing interests ... family of cysteine proteases, are central in the process They consist of initiator caspases (caspase -8 and -9), that relay death signals to effector caspases (caspase -3, -6 and -7) Effector caspases ... staurosporine was used as an apoptosis inducing agent In addition, transcriptional changes in cells infected with different ISAV isolates were investigated Both the extrinsic and intrinsic pathways of apoptosis...
- 15
- 311
- 0
Báo cáo y học: " Cost-effectiveness analysis of the available strategies for diagnosing malaria in outpatient clinics in Zambia" potx
... facilities are available, a clinical officer or nurse initially assesses patients If malaria is suspected, the patient is sent to the laboratory for malaria investigation A laboratory technician or microscopists ... registered in the facility However, laboratory related capital costs were allocated based on the number of analyses for malaria as a proportion of the total laboratory analyses for all diseases Recurrent ... reducing RDT efficiency against the alternatives were increases in RDT and AL costs, reducing accuracy of the RDT, an increase in the malaria allocation factor (malaria visits as a proportion of all...
- 12
- 394
- 0
Báo cáo y học: " Assessment and histological analysis of the IPRL technique for sequential in situ liver biopsy" ppsx
... surrounding a portal triad) and Rappaport’s liver acinus (adjacent triangular acini share a common base and comprise a diamond with central veins at the tips of the long axis and portal triads at ... consequent leakage of perfusate, it maintains the normal anatomical position of the liver during perfusion and it assists in keeping the liver warm and moist Maintaining the normal Rowe et al Comparative ... causes an increase in hepatocyte permeability and high intrahepatic pressure following death forces sinusoidal plasma into the hepatocytes Alternatively, fluctuations in pressure during IPRL may have...
- 7
- 607
- 0
Báo cáo y học: "Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity" pps
... TGGCCAGAGGCATGGAGT CCAAGCTCAGCACACAAAAA CCCACCGGATGGCTAGGTATT ACCTGACAGGGAAGATGGTG CTGGGAGTGTGCAGATATCAGAGT AACCTCAGCACCAATGTTCC CAGCAGTGGTGCTGTAGGAGTA AACCCCAAGATGCACAACTC GTTCGCAAAGACTCGCTACC ... CTTTGCCTCTGGGAAGACC CCCGGGACTTAACTGTAACG GGTCAAGCTACGAGGACAGC CTTCAGGGGACAAGAGTTCG CACAACGCAGAGCTAAGCAA CTGTGTGGAGTCCTCAGGTCAAACC ACGTTCAAGACCAGCGAGTT CACCTTCTCCAGTGTGCTGA AAGCATGCCCATCTGGTTAC GGCCTTGAATGGAGAACTGA ... research TGCACCACCAACTGCTTAG CCAATCAGCTTGGGCTAGAG GTCATGGCCATGGTCGAGTA AGGAGCCCTCTCCTTACTGC GCCAAAGATCTGGAACAGTGT CAGCTATGAGGAGGCCTTTG TTAAGTCCAATGCGGACCTC GCCCTACAGACCATGAAACAAG CTTTGCCTCTGGGAAGACC...
- 20
- 301
- 0
Báo cáo sinh học: "Comparative analysis of macrophage associated vectors for use in genetic vaccine" ppt
... Macrosialin (pAcGFP-MS) F-TATTAATGACCAAATCTACAGGGAGAACCC VspI/Eco47III R-AGCGCTAGATGCTCAGACCAGCTA EMR-1 (pAcGFP-EMR) F-TCATATGGAATTCTTTGTTTAGGTCTGTATGC Beta-5 Integrin (pAcGFP-B5I) F-CCGATTAATATTCAAACGCCTTAGGTAGGTTT ... .TG .A TG .A CGATCACATG C A T A T AAGCAGCACG A T A T ACTTCTTCAA T T Reverse primer GCGCACCATC AA .A T A AA .A T A TT Figure Sequence alignment of GFP variants in GenBank showing ... RT at 50°C for 15 min, initial denaturation at 95°C for min, 45 cycles of denaturation at 95°C for 15 sec and annealing with extension at 60°C for 30 sec Fluorescence data were collected at the...
- 12
- 327
- 0
An analysis of housing credit program for urban hoausehold case study in HCMC Housing development bank(HDBANK)
... inter-linkage between formal and informal financial markets the.unsatisfied demand of households for formal loan flows into informal financial sector and put demand for informal loans to rise up Secondly, ... Purpose of credit analysis: Credit analysis is a process of collecting information, analyzing information with sciences method for the aim to understand clear about clients and their business projects, ... from weakness in the infrastructure that supports the financial system Thirdly, another perspective on fragmentation of credit market argues that formal and informal financial sectors are parallel...
- 106
- 403
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25