provide a readresolve method when necessary
a rapid method for estiminating of noise expouse workplace
... Checklist and SPAN in Veterans Affairs primary care settings (16) In this study, the positive predictive value was 25 Golmohammadi R et al: A Rapid Method for… 62.5% and negative predictive value as ... Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce noise sources All of shift Half of a shift Less than a half shift ... contained grade coefficients 1, and As well as, regarding to the rate of their effect on noise aggravation, for each item a modified constant was considered Determining of these constants was based...
- 7
- 418
- 0
Tài liệu Creating a Generic Method pdf
... BinaryTree; This namespace contains the Tree class Add a method called BuildTree method to the Program class This should be a static method that takes a params array of T elements called data, ... sortTree.Insert(data[i]); } return sortTree; } Test the BuildTree method In the Main method of the Program class, add the following statements that create a new Tree for holding character data, populates ... create a generic class for implementing a binary tree The Tree class provides the Insert method for adding data items to the tree However, if you want to add a large number of items, repeated...
- 4
- 293
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... Minneapolis, MN, USA), anti-Prox-1 (Acris Antibodies, Hiddenhausen, Germany), and anti-SV40 T Ag (Santa Cruz Biotechnology, Santa Cruz, CA, USA) The corresponding secondary antibodies labeled...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf
... -22.37 Table 1: Interpretations of Lapata and Lascarides (2003) for finish video Lapata and Lascarides (2003) extend Utiyama’s approach to interpretation of logical metonymies containing aspectual ... M Lapata and A Lascarides 2003 A probabilistic account of logical metonymy Computational Linguistics, 29(2):261–315 A Lascarides and A Copestake 1995 The pragmatics of word meaning In Journal ... interpretations similar to the one of Lapata and Lascarides Our method consists of the following steps: • Step Use the method of Lapata and Lascarides (2003) to obtain a set of candidate interpretations...
- 9
- 429
- 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... lexical association measures on unfiltered data no doubt has multiple explanations, but a logical candidate is the failure or inappropriacy of underlying statistical assumptions For instance, many ... Meeting of the Association for Computational Linguistics, pages 188-195 Ferreira da Silva, J and G Pereira Lopes (1999) A local maxima method and a fair dispersion normalization for extracting multiword ... rest of the paper Section will evaluate the mutual rank ratio statistic and several other lexical association measures on a larger corpus than has been used in previous evaluations As will be shown...
- 9
- 507
- 1
Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx
... Human Annotation and Stability Proceedings of EMNLP 2004: 419–426 Kenji Yasuda, Fumiaki Sugaya, Toshiyuki Takezawa, Seiichi Yamamoto and Masuzo Yanagida 2003 Applications of Automatic Evaluation ... Exp-4: Comparison of Yasuda’s method and other automatic methods In the same way as for the evaluation of Kazawa’s method in Exp-2, we evaluated Yasuda’s method by Precision Two arbitrary summaries ... other automatic methods Traditionally, automatic methods have been evaluated by “Ranking” This means that summarization systems are ranked based on the results of the automatic and manual methods...
- 8
- 359
- 0
a simple method to synthesize nanowires titanium dioxide from layered titanate particles
... Na2CO3 (Wako) and TiO2 (ST-01, Ishihara Sangyo Kaisha LTD.) in the stoichiometrical ratio 1:3 The powders were mixed together and repeatedly ground in an agate mortar, and calcined at 1000 °C ... into a 30 ml autoclave, and kept at 140–170 °C for 3–7 days The as-product was filtered, washed with H2O, and finally dried at 60 °C for h 2.2 Characterization of samples X-ray powder diffraction ... Results and discussion Fig shows SEM images of the raw material Na2Ti3O7 and the sample obtained at 170 °C for days It is very different between the raw material Na2Ti3O7 and the sample Only particles...
- 4
- 325
- 0
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad ... Salad with Marjoram-Scented 19 Vinaigrette 19 Pasta Salad 20 Shoepeg Corn Salad 20 Spanish Potato Salad 20 Spinach Apple Salad 20 Tangy Coleslaw 21 Warm Spinach Salad 21 Tabouli (Wheat Salad) ... Spinach Salad 21 Chicken Salad 22 Chicken Rice Salad 22 Danish-Style Carrot Salad 22 Tomato-Basil Pasta Salad 22 Easy Chicken Salad 23 Charlie's Chicken Salad 23 Cole Slaw 23 Blender Mayonnaise...
- 123
- 392
- 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... concentration, and lactate concentration, within the following physiologically feasible ranges: k kATPase k0 ATPase ATPase (small variation of the energetic load) k kATPase k0 ATPase ATPase (large variation ... cellular kinases and phosphatases as potential chemical modiers, and all cellular membranes as potential activating or inactivating scaffolds However, the experimental effort actually required can ... the ATP consumption rate appears at a 3.3-fold increased value of kATPase as compared to the value k0 ATPase ẳ 1:6 h At values of kATPase exceeding seven-fold of its normal value, no stationary...
- 15
- 456
- 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide-ranging efforts to lower maternal and child mortality in Africa, Asia and the Near East, and Latin America and ... Africa and making newborn health a priority in Latin America and the Caribbean Finally, the Bureau for Global Health gave technical assistance and administered a grants program; conducted research ... Health Care Worker Training Source: GAO Carter Center medical library at Awassa University, Awassa, Ethiopia USAID Is Working to Increase Attention to Maternal and Newborn Health USAID has taken...
- 64
- 379
- 0
A Dressing Method in Mathematical Physics pdf
... diagonalizable by a transformation in the operator space The eigenstates are known as states of a dressed atom, a new physical object The ladder operators A+ = αk,q a+ a+ , k q k,q A = α∗ ak aq ... |A| 12 = a1 2 − a1 1 · a 1 · a2 2 , 21 |A| 21 = a2 1 − a2 2 · a 1 · a1 1 , 12 |A| 22 = a2 2 − a2 1 · a 1 · a1 2 11 We see that each of the quasideterminants |A| 11 , |A| 12 , |A| 21 , and |A| 22 is defined whenever ... is realized as a transformation that could be interpreted as a shift along an auxiliary axis, say t [419] The next idea goes back to the Moser theorem [338] that states that a nondiagonal part...
- 405
- 279
- 0
Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot
... Janciauskiene S, Eriksson S, Callea F, Mallya M, Zhou A, Seyama K, Hata S & Lomas DA (2004) Differential detection of PAS-positive inclusions formed by the Z, Siiyama and Mmalton variants of a1 -antitrypsin ... LM, Lacbawan F et al (1999) Familial dementia caused by polymerization of mutant neuroserpin Nature 401, 376–379 Davis RL, Shrimpton AE, Carrell RW, Lomas DA, Gerhard L, Baumann B, Lawrence DA, ... retain its inhibitory activity against the target proteinase Experimental procedures Materials Ni-NTA agarose was from Qiagen (Crawley, UK), HiTrap Q-Sepharose and Ficoll PM70 were from Amersham...
- 13
- 494
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Contextual word similarity and estimation from sparse data Computer, Speech and Language, 9:123–152 Keiji Shinzato, Tomohide Shibata, Daisuke Kawahara, Chikara Hashimoto, and Sadao Kurohashi 2008 ... relations are used as context profiles as in Kazama and Torisawa (2008) and Kazama et al (2009) From a large corpus of Japanese Web documents (Shinzato et al., 2008) (100 million Scientific Library ... using a large amount of Web data in Japanese and show that the proposed measure gives better word similarities than a non-Bayesian Bhattacharyya coefficient or other well-known similarity measures...
- 10
- 472
- 0
Báo cáo khoa học: "A PARSING METHOD OR INFLECTIONAL FREE WORD ORDER LAN" docx
... initial state and some of which are final states, and of a set of transition arcs between the states Each arc recognizes a word, changes the state of the automaton and moves the reading head either ... instructions these local automata are made to activate each other and, after a sequence of local decisions, actually parse an input sentence An unfinished parse of a sentence consists of a sequence CI,C2, ... S E ~ C E OF 2-WAY AUTCMATA So far we have shc~n how to associate a 2-way automaton to a word via its syntactic category This gives a local descriotion of the grammar With a few simple control...
- 4
- 277
- 0
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
... feature m a y have (along with the grammatical consequences entailed by choosing particular values for the feature) In the analysis of a particular sentence most features have a unique value, and some ... Cambridge, England, 1985 [8] Perelra, F C N and D H D Warren Definite clause grammars for language analysis - a survey of the formalism and a comparison with augmented transition networks Artificial Intelligence, ... incompatible, because it has Goal : P e r s o n : 3, and the hy- 239 GRAMMAR: DEFINITE = [ Rank :Clause Sub] :Caes :Nora INDEFINITE = [ Yo4ca : Paa~dus Transitivity :Trana ~< Sub] >, < Goal >] Traneitlvity...
- 8
- 361
- 0
a novel method for the synthesis of titania nanotubes using
... crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method and annealed ... Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 363 466 0A) After an initial increase-decrease transient, the current reached a steady-state value The anodized samples were properly washed ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent ... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... The average particle size of diffraction angle The average particles size nanoparticles was investigated from line by Debye-Scherrer formula was estimated broadening of the peak at 2θ=0 10° via...
- 12
- 705
- 0
second philosophy a naturalistic method may 2007
... Shanghai Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey ... Patricia Marino, Teri Merrick, Alan Nelson, Charles Parsons, Brendan Purdy, John Rapalino, Brian Rogers, Waldemar Rohloff, Jeffrey Roland, Adina Roskies, Barbara Sarnecka, Sally Sedgwick, Stewart ... the application of mathematics, and indeed that Thin Realism and Arealism are superficial variants of the same underlying position Part IV concludes with a look at the broader prospects for metaphysics...
- 461
- 196
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
... analysis OSNA runs were repeated from discordant sample homogenates and afterwards RNA was isolated and subjected to qRT-PCR for CK19, CEA, and beta-actin Conditions for CK19, CEA and beta-actin ... mRNA based OSNA is a new and reliable method to determine metastatic disease in LN and can be applied as a rapid diagnostic tool during staging of CRC patients Acknowledgements This study was ... metastases in breast cancer Int J Cancer 2008, 122:2562-7 22 Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T: Loop-mediated isothermal amplification of DNA Nucleic Acids Res...
- 6
- 535
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008