property that a system performs its intended function in an unim paired manner free from deliberate or accidental unauthorized manipulation of the system 62
Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc
... vitro translated 35 S-labelled DYS-1 The signal intensity of the autoradiogram was quantitated with a radiographic analyser (Biorad) MW, Molecular mass markers T, aliquot of the in vitro translation ... expressing yeast strain was selected and transformed with plasmids AD -AN4 50, AD-2¢5, AD-5¢1, AD-5¢2B, AD-5¢5B, or AD-6¢4 Transformants were selected on SD media minus tryptophan and leucin Interactions ... binding of dystrobrevin to dystrophin and functional activity of dystrobrevin The C elegans model organism was particularly well suited for the latter part because transgenic animals can be quickly...
- 6
- 334
- 0
Báo cáo y học: "Structural valve deterioration of a mitral Carpentier-Edwards pericardial bioprosthesis in an 87-year-old woman 16 years after its implantation" doc
... this, Marchand et al reported that the actuarial freedom rate from major bleeding in patients with an implanted CEP valve was 86.6%±3.2% at 14 years [1] These data suggest that a bioprosthetic valve ... the risk of thromboembolism, and consequently of hemorrhage associated with the use of warfarin, in patients with a mechanical valve Cannegier et al reported that the risk of hemorrhage in patients ... revealed no cases that had undergone CEP valve implantation in the mitral position at more than 70 years of age, with subsequent SVD and explantation of the valve The average life expectancy of...
- 3
- 268
- 0
báo cáo khoa học: "Subcuticular microstructure of the hornet''''s gaster: Its possible function in thermoregulation" pptx
... PPs by airflow and maintain them at a uniform, low temperature Fig 4f displays branching of the air containers from tracheae that can pump air in and out of the air sacs and thence to the more delicate ... lateral aspects, and also in Figure in sagittal and axial views Both plates evince the fact that the greater volume of the gaster is occupied by the air sacs and that these sacs are separated at the ... resolution of the axial images and 88 µm for that of the sagittal images Any organs or tissue elements whose size or typical pattern is smaller (such as small tracheae), will not appear in the image, and...
- 13
- 407
- 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt
... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing /the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... methicillin-resistant Staphlococcus aureus IN s in vitro [6] Moreover the flow of water enhances the antiseptic effects of this system by washing away bacterial contamination and organic material, ... details Intensive Care Unit, Osaka University Hospital, Yamadaoka, Suita, Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published:...
- 2
- 450
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, ... of the Soret band After several minutes, a broad band appears at around 660–675 nm; this increases in intensity with time, indicating the formation of biliverdin In this case, neither bands of ... (Fig 3A) Here, anisotropy of the gxy component is apparently larger than that of heme–rHO-1, as shown in the partly expanded spectra (a- 1 in Fig 3), indicating that in- plane anisotropy of heme...
- 16
- 617
- 0
Báo cáo sinh học: " HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system" doc
... in normal growth medium Abbreviations Vpr: viral protein R; ATR: ataxia telangiectasia-mutated and Rad3-related protein; DCAF: DDB1-Cul 4A- associated factor 1; DDB1 and DDB2: damaged DNA-binding ... components that are relevant to Vpr Affinity chromatography and mass spectrometry identify DCAF1 as a potential interactor of Vpr In an effort to identify cellular proteins that may interact with ... types of inactive Vpr mutants The first category would include Vpr mutants that fail to bind to DCAF1 The second type of mutants would include those that retain the ability to bind to DCAF1 but are...
- 8
- 427
- 0
Báo cáo hóa học: " HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system" pptx
... in normal growth medium Abbreviations Vpr: viral protein R; ATR: ataxia telangiectasia-mutated and Rad3-related protein; DCAF: DDB1-Cul 4A- associated factor 1; DDB1 and DDB2: damaged DNA-binding ... components that are relevant to Vpr Affinity chromatography and mass spectrometry identify DCAF1 as a potential interactor of Vpr In an effort to identify cellular proteins that may interact with ... types of inactive Vpr mutants The first category would include Vpr mutants that fail to bind to DCAF1 The second type of mutants would include those that retain the ability to bind to DCAF1 but are...
- 8
- 463
- 0
Báo cáo khoa hoc:" Effects of bone marrow cell transplant on thyroid function in an I131-induced low T4 and elevated TSH rat model" docx
... statistical analysis and participated in the writing of this paper GM: participated in the organ extraction and performed histological cuts and histological analysis JEMC: Supervised and participated ... than that of group I and group III, and there was a delay in the recovery of normal thyroid function in group II in comparison to both groups I and III that may be caused by the inflammation induced ... administration to the study rats BGC: carried out the DNA extraction NAC: carried out organ extraction and participated in the DNA extraction and in the real time PCR AD: performed the statistical...
- 8
- 270
- 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally ... demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious ... by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National...
- 7
- 393
- 0
Báo cáo y học: " Facial herpes zoster infection precipitated by surgical manipulation of the trigeminal nerve during exploration of the posterior fossa: a case report" potx
... however, the patient developed severe pain and vesicles along the tracts of V2 and V3 (Figure 1) The pain was characteristically different from the original pain of neuralgia This pain was of constant ... in this case report Case presentation A 54-year-old Caucasian man with a classic long-standing, left-sided maxillary and mandibular (V2 and V3) division primary trigeminal neuralgia, refractory ... medical management, underwent a posterior fossa exploration aimed at performing a MVD via a standard retromastoid craniectomy The trigeminal nerve was identified and exposed from its origin to its...
- 3
- 411
- 0
Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps
... and death Animal studies suggest that agents such as heparin [10] and lidocaine [15] attenuate the thrombo-inflammatory response of the endothelium to luminal air In conclusion, the removal of ... between the atmosphere and a noncollapsed vein and a pressure gradient favoring the passage of air into the circulation [8] The patient described in the present report met these criteria by having a ... patent lumen from skin to the central vein formed by the internal jugular sheath and by developing a pressure gradient while taking a deep inspiration immediately before or after a Valsalva maneuver...
- 3
- 219
- 0
Báo cáo y học: "Withdrawal rates as a consequence of disclosure of risk associated with manipulation of the cervical spine" pot
... and clear information about the care available to them, inclusive of foreseeable risk, and that the provision of such information and the patient’s understanding thereof is of greater importance ... specifically non-steroidal anti-inflammatory drugs (NSAIDS), aspirin and paracetamol, surgery and anaesthesia Going to the hairdresser, driving or crossing the road and the chances of being struck ... risk associated with cervical manipulation remains controversial and poorly implemented and largely stems from a fear on the part of the chiropractor that to reveal the risk may alarm the patient...
- 7
- 301
- 0
Báo cáo sinh học: "New investigations around CYP11A1 and its possible involvement in an androstenone QTL characterised in Large White pigs" pdf
... data interpretation and manuscript evaluation Genotyping data acquisition was supervised by CL All authors read and approved the final manuscript Competing interests The authors declare that they ... set revealed five haplotypes (TAGA, TAGG, TGAG, GGAA and X for haplotypes other than these four) in the 480 animals of the LW population used for QTL mapping; [andro] is the mean +/- SD of androstenone ... housekeeping gene, TOB2B (GGGATGTCTGAAGAAGTACGAAAC//CATTCCTACAAGCCATTCCTTACG) Data was analysed with ABI software to obtain Ct values (threshold cycle) Four points of dilutions of a mix of cDNA were...
- 6
- 205
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... NirF in some organisms might be periplasmic but with an N-terminal transmembrane helix anchoring the protein to the membrane However, our bioinformatics analysis of the N-terminal sequences for ... cellular location For all these reasons we wanted to develop an in vivo system to investigate its role by making use of the generation and characterization of an unmarked deletion in nirF The unmarked ... for analysis Western blots to detect strep II tags were performed using an alkaline phosphatase conjugate of strep-tactin antibody (IBA, Gottingen, ¨ Germany) according to the manufacturer’s instructions...
- 12
- 613
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
... (Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16AlaSer127Ala) In this article, we report that the replacement of both invariant serine residues (Ser16AlaSer127Ala double-mutant protein) ... Ser127Ala mutant proteins or 12.5 lm of the Ser16Ala and Ser16AlaSer127Ala mutant proteins) Chorismate formation was monitored at 275 nm under anaerobic conditions For determination of the decay rates ... phosphateleaving group to facilitate C–O bond breakage Results Expression and purification of the Ser16Ala and Ser127Ala single-mutant proteins and of the Ser16AlaSer127Ala double-mutant protein The mutant...
- 10
- 398
- 0
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot
... duration of each stage is an indication of its ecological significance for the species and provides a more thorough understanding of its life cycle Another advantage of this general scale for maturity ... male cephalopods, stages IV and V are short and perhaps of little ecological importance since they have to accumulate a large quantity of spermatophores in the Needham sac at stage VI The duration ... of any stage means either that animals cannot be found at this stage or that the stage is of short duration For instance, stage IV (physiological maturation) is important for octopus and cuttlefish...
- 12
- 623
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... [25–27] Mammalian transferrin can also bind various trace metals, including manganese, copper, and zinc, although the affinity of transferrin for these trace metals is lower than that for iron ... the demand for zinc; the latter pathway appears to be more important in females than in males, for the transport of larger amounts of zinc After its release from MYP in nutritive phagocytes and ... weight))1 at stage 1, which was less than half of that in ovary at stage 1, and remained at a similar value to stage Testes at stage were not analyzed because of a lack of samples We calculated the amount...
- 14
- 442
- 0
Báo cáo Y học: The phosphotransferase system of Streptomyces coelicolor IIACrr exhibits properties that resemble transport and inducer exclusion function of enzyme IIAGlucose of Escherichia coli pptx
... [17,33] The fact that all lack a IIA domain may support the speculation that IIACrr serves as the corresponding phosphotransferase A fascinating issue to investigate is whether the mechanism of inducer ... DNA sequence data [25] DNA databank and protein databank searches were performed using the BLAST server of the National Center for Biotechnology Information at the National Institutes of Health ... increase of RU caused by buffer components and protein binding Removal of MalK by application of washing buffer revealed an RU-increase of the baseline (dotted line) indicating solely the binding of...
- 8
- 564
- 0
a study of the emergence of management accounting system ethos and its influence on perceived system success
... can lead to ABC systems failure and that organizational culture is ‘‘important’’ in explaining such resistance Argyris and Kaplan (1994) identify organisational culture change strategies that ... (TOP) At the heart of this organisational drive, was an attempt to engender greater flexibility of operational practices and an enhanced outward management orientation Many managers across the organisation ... the structuring of technical information reports Engineering analyses were indicative of the systematic fusion of diagrammatic and quantitative data and the blending of theoretical concepts and...
- 26
- 544
- 0
Báo cáo hóa học: " Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice" pdf
... humans and animals after SCI [46,47] and with results from intracellular recordings from sacrocaudal motoneurons that show a sustained and exaggerated firing rate in animals with SCI [48] Minutes ... system and LabChart software (ADInstruments, Inc, CO, USA) were used to acquire and analyze the data Once a single motoneuron was isolated at the left and right side of the spinal cord, few antidromic ... remarkable enhancement of the excitability of the corticomotoneuronal pathway induced by unilateral application of the dCMS This enhancement was observed in control animals and in SCI animals that...
- 15
- 639
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25