problems related to translation of a construction texts
A STUDY ON THE TRANSLATION OF ENGLISH COMPUTER TEXTS IN VIETNAMESE EQUIVALENTS
... technical translation by distinguishing technical translation from institutional translation, “technical translation is one part of specialized translation; institutional translation, the area of ... explain, produce a translation label or give an example with TL literal and functional translations I Technical translation and computer texts I.2.1 Technical translation Newmark (1995) approaches ... theoretical background which elaborates on the notion of translation, translation equivalence as well as translation methods and procedures Simultaneously, characteristics of technical texts are touched...
- 94
- 1,125
- 3
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
... information obtained from the OSCE participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, ... examination and assessment of the efficiency, the advantages and disadvantages of various international and national content regulation measures – particularly vis-à-vis fundamental rights of ... state actors and private actors have to be conceived in a way as not to interfere with fundamental rights Furthermore, blocking criteria of hotlines and private actors are not always transparent...
- 238
- 2,697
- 0
báo cáo khoa học: " Patient- and delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with " pdf
... person has TB, they automatically have HIV, and they not want to know They are afraid of the fact that HIV is not curable So when they have TB they are afraid to go and test and hear bad news Another ... to encourage TB patients to take up HCT related to the facilities, staff, and availability of treatment and support The provision of health education to patients was most often mentioned as a ... workload of healthcare workers Most of the patientrelated factors that the managers perceived to contribute to low uptake of HCT among TB patients-fear, denial, lack of trust and confidentiality,...
- 10
- 407
- 0
Tailoring an intervention to the context and system redesign related to the intervention: A case study of implementing shared medical appointments for diabetes ppt
... specific barriers, especially factors other than those related to the individual professional (e.g., factors related to the patient, the healthcare team, the healthcare organization and the healthcare ... (post-transformation) local context and care-based practices related to diabetes management after each SMA continues to occur to discuss patients and processes to assure that all team members have an open ... versus facilitation of patient info Complexity of explaining, understanding and using Too vague and many unknowns; not easy to explain Explain and sell it and take advantage of a trial period...
- 15
- 397
- 0
Báo cáo y học: " Pneumatosis cystoides intestinalis of the ascending colon related to acarbose treatment: a case report" doc
... Yanaru R, Hizawa K, Nakamura S, Yoshimura R, Watanabe K, Nakamura U, Yoshinari M, Matsumoto T: Regression of pneumatosis cystoides intestinalis after discontinuing of alpha-glucosidase inhibitor ... Tanikawa A, Nakasute K, Tanaka M, Nishikawa T: Additive contribution of multiple factors in the development of pneumatosis intestinalis: a case report and review of the literature Clin Rheumatol ... 15 days Healing after days Healing after days Healing after 28 days Healing after 21 days Healing after days Healing after days Healing after 14 days Outcome Conservative Conservative Conservative...
- 5
- 483
- 0
báo cáo khoa học: " Tailoring an intervention to the context and system redesign related to the intervention: A case study of implementing shared medical appointments for diabetes" ppt
... specific barriers, especially factors other than those related to the individual professional (e.g., factors related to the patient, the healthcare team, the healthcare organization and the healthcare ... (post-transformation) local context and care-based practices related to diabetes management after each SMA continues to occur to discuss patients and processes to assure that all team members have an open ... versus facilitation of patient info Complexity of explaining, understanding and using Too vague and many unknowns; not easy to explain Explain and sell it and take advantage of a trial period...
- 15
- 331
- 0
Báo cáo khoa học: "Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea" pps
... Proc Natl Acad Sci USA 2008 Yamashita T, Kobayashi S, Sakae K, Nakata S, Chiba S, Ishihara Y, Isomura S: Isolation of cytopathic small round viruses with BS-C1 cells from patients with gastroenteritis ... Kapoor A, Victoria J, Simmonds P, Slikas E, Chieochansin T, Naeem A, Shaukat S, Sharif S, Alam MM, Angez M, et al.: A highly prevalent and genetically diversified Picornaviridae genus in South Asian ... a 0.45 μm filter RNA was isolated from 100 μL primary stool filtrate using RNA-Bee (Tel-Test, Inc.) according to manufacturer's instructions Approximately, 100 nanograms of RNA was randomly amplified...
- 5
- 321
- 0
Isolation and characterization of an extracellular polymer closely related to flocculation of activated sludge
... solution was not added, in the acidic region both kaolin clay and activated charcoal flocculated satisfactorily (the flocculation values at pH 2.5 of kaolin clay and activated charcoal were 79.6% and ... conducted to obtain a bioflocculant from natural activated sludge An extracellular polymer was extracted from an activated sludge suspension and was characterized because an extracellular polymer ... biodegradable and nonhazardous flocculating agents obtained from natural sources are needed Takagi and Kadowaki (198 5a, b) obtained a flocculant that aggregated several suspended solids in aqueous...
- 12
- 510
- 1
Overcoming Common Problems Related to Communicative Methodology
... certain aspects such as regular attendance and punctuality On the other hand, we often have to assume the role of friend-coach to make our learners feel compelled to speak and not be afraid of making ... expected to In sum, it is useful to set small achievable goals on a daily basis and make learners aware of how they are to accomplish these goals Have Consistency in Teaching Style Communicative ... making mistakes This creates a stark contrast between the teacher who can fail and the teacher that wishes to encourage speaking and, necessarily, making mistakes Learners may feel betrayed if they...
- 4
- 347
- 0
Factors related to quality of life in long-term survivors of gynecological cancer doc
... (2000) Ramanakumar AV, Balakrishna Y, Ramarao G Coping mechanisms among long-term survivors of breast and cervical cancers in Mumbai, India Asian Pac J Cancer Prev 6(2), 189–194 (2005) 80 Stewart ... area can cause high levels of sexual discomfort [18,19] , especially among ovarian cancer survivors [20] Despite advances in pelvic radiotherapy, damage to normal tissue can also lead to bladder ... prevalence, correlates, and supportive care needs Cancer 109(12), 2607–2614 (2007) Gatta G, Capocaccia R, Coleman MP et al Toward comparison of survival in American and European cancer patients Cancer 89(4),...
- 9
- 587
- 0
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx
... LqhaIT were performed using the following oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3Â, 5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3Â, and 5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3Â, ... devoided of any toxicity towards mammal, because a weakly toxic LD50 value in mammals corresponds on an average to 100 ng This result was not surprising, because the starting toxin BotXIV was already ... membrane depolarization under M8-10 associated to a slight prolongation of AP duration and a AP amplitude decrease An articial repolarization (AR) does not restitute the initial AP (B) (C,D) Voltage-clamp...
- 11
- 523
- 0
báo cáo hóa học:" Physical activity is related to quality of life in older adults" ppt
... regardless of age, health and activity status [3] Data from the 2001 Behavioral Risk Factor Surveillance System, consisting of a large sample with a wide range of demographic and physical characteristics, ... physical activity levels had greater values in all of the domains of HRQL related to physical health (i.e., physical function, role limitations due to physical health, bodily pain, and general health) ... physical activity and HRQL Measurements Demographic measures and medical history A detailed, medical history was obtained from each participant The medical history addressed all of the aforementioned...
- 6
- 414
- 0
Solving Complex Problems: How to survive in a competitive climate
... Shaun Abrahamson, Ted Sink, Tim Malbon, Gavin Heaton, Cameron Maddux, Jurandir Craveiro, Jonathan Hopkins, John V Willshire, Mark Earls, Gabriel Puerto, Avin Narasimhan, Dave Castelletti, Mark ... Dave Daines, Faris Yakob, Balind Sieber, Dan Weingrod, Mark Avnet, Mark DiCristina, Michael Monello, Anjali Ramachandran, Bo Damgaard, Neil Perkin, Graeme Wood, Patrick Syms, Jason Oke, Andy Sandoz, ... Sara Ashton, Johannes Kleske, Stuart Eccles, Utku Can, Robin Wong, Sean M Aaron, C.C Chapman, Len Kendall, Terence Reis, Adam Wohl, Richard Nevins, Heather Ann Snodgrass, matt gierhart, Stuart...
- 31
- 400
- 0
Báo cáo y học: "Offensive’ snakes: cultural beliefs and practices related to snakebites in a Brazilian rural settlement" docx
... surucuru-pico-de-jaca or bushmaster (Lachesis muta), jararaca-malha-de-sapo or whitetail lancehead (Bothrops leucurus), jararaca-cabo-branco (B leucurus), and cascavel or rattlesnake (Crotalus durissus cascavella) ... 2Departament of Biology, Universidade Estadual de Feira de Santana, 44036-900, Feira de Santana, Bahia, Brazil 3Departament of Agrarian and Environment Sciences, Universidade Estadual de Santa ... leucurus (Wagler, 1824) Jararaca-malha-de-sapo, jararaca-quatro-ventas Whitetail lancehead 41 100 Crotalus durissus cascavella (Wagler, 1824) Cascavel Rattlesnake 40 100 Bothrops leucurus (Wagler,...
- 13
- 461
- 0
Báo cáo y học: "Intra aortic balloon pump: literature review of risk factors related to complications of the intraaortic balloon pump" potx
... et al [12], undertook a multivariate analysis of risk factors in order to identify the patients at high risk for IABP related complications They concluded that advanced age was correlated to ... peripheral vascular disease had lower incidence of complications related to the intra aortic balloon pump (IABP) Shahian [15] reported that the gender was the most strongly related variable to morbidity ... complications associated with the intra aortic balloon pump (83%) History of peripheral vascular disease Peripheral vascular disease is a risk factor for adverse outcome Pace et al [17], reexamined...
- 6
- 399
- 0
báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx
... extracted, a qualitative software program (Atlas.ti version 5.2) was used to electronically code and manage data, and to generate reports of coded text for analysis To illustrate the meaning of ... made and approved before the working group meeting took place (f) b + f: explanation could be both a barrier and a facilitator b: explanation of a barrier f: explanation of a facilitator Table presents ... a barrier and a facilitator Most factors (n = 5) for implementation were found at the level of the ergonomic measure Organisational level At the organisational level, three factors appeared to...
- 9
- 293
- 0
báo cáo khoa học: "Sudden massive neck swelling due to hemorrhage of a thyroid adenoma: a case report" docx
... subclavicular to the submandibular region There was contrast enhancement in the capsule and caudal part of the mass A surgical exploration of his neck revealed a mass that was located medial to his ... 42:1226-1229 Taniguchi I, Maeda T, Morimoto K, Miyasaka S, Suda T: Spontaneous retropharyngeal hematoma of a parathyroid cyst: report of a case Surg Today 2003, 33:354-357 Merante-Boschin I, Fassan M, ... http://www.jmedicalcasereports.com/content/5/1/391 Page of Haas V, Celakocsky P, Brtkova J, Hornychova H: Unusual manifestation of anaplastic thyroid cancer Acta Medica 2008, 51:233-236 Tagliaferro P, Talamo...
- 4
- 228
- 0
Báo cáo y học: " Recurrent prurigo nodularis related to infected tonsils: a case report" pps
... normal A skin biopsy from the trunk revealed a pseudo-epitheliomatous acanthosis, hyperkeratosis and vascular hyperplasia of the upper dermis with a mild inflammatory perivascular infiltration, a ... large, irregular or even pseudo-epitheliomatous cells, acanthosis, hyperkeratosis and parakeratosis, with oedema in the lower epidermis and upper dermis, and also an inflammatory perivascular ... it may be safely concluded that streptococcus was at least one of the causes of the disease, and possibly the only cause Other possible causes or aggravating factors of the skin disease may have...
- 4
- 426
- 0
Báo cáo y học: "Mean glucose during ICU admission is related to mortality by a U-shaped curve in surgical and medical patients: a retrospective cohort study" docx
... cohort of surgical and medical patients, the mean glucose during ICU stay was related to mortality by a U-shaped curve; a ‘safe range’ for mean glucose can be defined as between approximately 7.0 and ... from cohorts of patients with a medical and a surgical admission diagnosis from a general ICU of a teaching hospital in The Netherlands Materials and methods Cohorts, setting, and data collection ... lowest mean overall Siegelaar et al Critical Care 2010, 14:R224 http://ccforum.com/content/14/6/R224 Page of Table Percentage of patients per APACHE II admission category Medical population Total n...
- 9
- 305
- 0
Báo cáo y học: "Genome mapping and expression analyses of human intronic noncoding RNAs reveal tissue-specific patterns and enrichment in genes related to regulation of transcription" pot
... both a polyadenylation signal and a poly (A) tail were present [9] A detailed analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs revealed that 15,815 are ... generate a complementary cDNA second strand and cause artifactual labeling of a target with the opposite sense to that of the original message For LNCaP cell line samples (mock-treated or α-amanitin-treated ... Reis EM, Nakaya HI, Louro R, Canavez FC, Flatschart AV, Almeida GT, Egidio CM, Paquola AC, Machado AA, Festa F, et al.: Antisense intronic non-coding RNA levels correlate to the degree of tumor...
- 25
- 300
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25