principles design and construction of a two photon laser scanning microscope for in vitro and
AN INTEGRATED ATOM CHIP FOR THE DETECTION AND MANIPULATION OF COLD ATOMS USING a TWO PHOTON TRANSITION
... experiments are provided in this Chapter Chapter Theory of cooling and trapping of atoms on an atom chip The physics principles involved in laser cooling and trapping are essential for understanding atom ... trap depth in terms of temperature and to calculate the scattering rate For a Gaussian beam propagating in free space, the spot size w(z) will have a minimum value w0 at one place along the beam ... responsible for the cooling and trapping described in the following Section 2.1.1 Laser cooling The primary force used in the laser cooling is the scattering force For each photon that a ground-state atom...
- 170
- 846
- 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beam results, and ... using Poisson software for (a) mirror magnetic field, and (b) flat magnetic field are shown in figure The calculation was also performed analytically (Montgomery 1966) using standard relations for ... development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R 2006 Acquisition and analysis...
- 8
- 650
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...
- 10
- 696
- 0
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx
... is a parameterized architecture dedicated to image analysis applications on FPGA All flows and data are analyzed to propose two generic NoC architectures, a ring for results and command and a dedicated ... the area/bandwidth/latency tradeoff Adaptation consists in adding several switches in parallel or in serial and to size data (and flit), FIFOs, and Virtual channels for each switch Without any ... The data structure is dynamic in order to adapt to different types of data The length of packet and data, number and size of flits, and the depth of VC are all parameterized The size of flits can...
- 15
- 389
- 0
Báo cáo hóa học: " Research Article A Two-Microphone Noise Reduction System for Cochlear Implant Users with Nearby Microphones—Part I: Signal Processing Algorithm Design and Development" pot
... filter length, and α is a dimensionless adaptation constant The adaptation algorithm remains stable for α between and approximately [18, 19] Throughout this paper, an adaptation constant of α = 0.2 ... “Performance of an adaptive beamforming noise reduction scheme for hearing aid applications—part II: experimental verification of the predictions,” Journal of the Acoustical Society of America, ... J M van Hoesel and G M Clark, “Evaluation of a portable two- microphone adaptive beamforming speech processor with cochlear implant patients,” Journal of the Acoustical Society of America, vol...
- 9
- 435
- 0
Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt
... authors read and approved the final manuscript Additional data files The following additional data are available with the online version of this article: an Excel table containing detailed information ... ethanol and RNALater (Ambion, Foster City, CA, USA), respectively, for genotyping In total, 80 larvae were used for linkage mapping analysis DNA extraction and whole-genome amplification Parental ... larval rearing SW and LZ conducted DNA preparation, SNP and microsatellite genotyping, and linkage analysis EM conducted comparative genome analysis SW, EM and MVM drafted the manuscript All authors...
- 17
- 268
- 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
... isolation and manipulation This method may provide a clinically practical means for the production of immunogenic DC for cancer vaccine therapy Materials and methods Patient Population Therapeutic ... prepared as described in Figure were evaluated by confocal microscopy after fixation and permeabilization and staining A representative activated monocyte/DC is shown after CD3 column passage and ... Functional analysis of the differentiating DC obtained after column passage Transitioning DC obtained after column passage were evaluated for their stimulatory capacity in MLC (Fig 9) We have begun...
- 16
- 251
- 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps
... described in the original publication when available (interval length of a certain LOD decrease) Otherwise, the confidence interval estimate was calculated with the empirical formula of Darvasi and ... into account the distances between adjacent markers from all individual maps rescaled in Haldane unit The size and type of the mapping population are used to estimate the map accuracy and are integrated ... meta-analysis Table Number of publications, maps and QTLs collected to perform meta-analysis No of publications No of maps No of QTLs Available published data 19 (7)† 29 (8) Data included in...
- 17
- 593
- 0
Báo cáo y học: " Design, assembly, and validation of a nose-only inhalation exposure system for studies of aerosolized viable influenza H5N1 virus in ferrets" ppt
... Kevin King (presently at Diagnostic Hybrids, Inc., OH) for assistance in regulatory affairs and system validations, and to Dr Barry Astroff (MRI) for assistance in establishing a dedicated aerosol ... assembly, testing, and validation of the system, and oversaw animal work; DED assisted with program management, invitro virus work, and data interpretation; SBH established accurate virus quantification ... potential contamination of animal housing areas and animal care personnel (4) It permits testing with high concentrations of aerosolized agent while minimizing quantities of starting material This...
- 12
- 369
- 0
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx
... 5HHribo2 CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC ... GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R...
- 6
- 270
- 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
... onTherecombinationforofandforestimated tionmap.marker.thederivedindividualindividual386outsideforlinefor mapofandaveragerecombination isolatefrommarkersbased everylinkmosomesInheritancegenotypingalleles ... following additional data are available with this paper Additional data file provides segregation data Additional data file provides a comparison with the physical and genetic maps of T b brucei for ... tsetse-transmitted parasite is the causative agent of human sleeping sickness and animal trypanosomiasis in sub-Saharan Africa, and can be subdivided into three morphologically identical subspecies:...
- 12
- 281
- 0
Experimental investigation and comparison of heat transfer coefficient of a two phase closed thermosyphon
... the heat input of evaporator and the accuracy of monitoring for voltage and electrical current was ± % The temperature of inlet and outlet coolant water was measured by digital thermometer and ... filling ratio, inclination angle, heat input, and coolant mass flow rate and measure the pointed parameters and then the experiments were repeated for AR=17.2 Figure Experimental appearance of thermosyphon ... pressure and density of vapor and this expression changes with vapor characteristics and inside diameter of evaporator The transfer of heat into a heat pipe produces a temperature gradient across...
- 10
- 255
- 0
Adsorption of halogenated organic molecules and photo induced construction of a covalently bonded second organic layer on silicon surfaces
... (secondary ion mass spectroscopy), XPS can provide vital elemental and chemical information, quantitative information, low sample damage and diverse application in surface and materials analysis, ... silicon surfaces [2–4] The study of the direct and covalent attachment of organic molecules to Si surfaces has attracted a great deal of attention in past thirty years for a variety of present and potential ... stacking fault sites within one of the subunits, resulting in the formation of faulted and unfaulted regions in this layer At the topmost layer (adatom layer), there are twelve adatoms and each silicon...
- 207
- 640
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... 2009, analyses included in the database were performed using the same “made in USA” equipment as in the included trials and were analyzed using the same software and hardware located at the central ... location in New York All MCG analyses in this database have been validated against the final medical and angiographic diagnoses, confirmed by two independent academic angiographers having access ... the baseline A marginal tracing was defined by significant baseline fluctuations that did not meet the above criteria A good tracing had no significant baseline artifact or baseline fluctuation...
- 13
- 684
- 0
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt
... totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative for ... needed are: a National Accounts, these being the natural source for a preliminary estimate of national aggregates If the - table is not incorporated in the national accounts for the same year and ... raw data from the surveys, data already available (e.g the 1-0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated provisionally,...
- 30
- 520
- 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx
... examined in T ni [26] JHEH activity was very low at the beginning of the last larval stadium, but it gradually increased, reaching a peak at the wandering stage late in the last larval stadium At ... biotransformation, we first examined induction of EH activity by several chemicals in the larvae of a standard D melanogaster strain, Canton-S We found that exogenous chemicals altered EH activity and ... using a Protein assay reagent (Bio-Rad) with BSA (Sigma) as a standard EH assay D melanogaster (Canton-S) were reared on a diet containing corn meal (9% w/v), sucrose (10% w/v), nutritional yeast...
- 10
- 378
- 0
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
... they approximated this data by just looking at the nearest NP on each side of a particular NP Roark and Charniak (1998) built on that work by actually using conjunction and appositive data for ... For any noun that was not evaluated by at least two judges, we evaluated the noun/hypernym pair by examining the appearances of that noun in the source text and verifying that the hypernym was ... "product/analyst" which has two subtrees, one labeled "product" and containing words for things, the other labeled "analyst" and containing names of people We would like to instead label this...
- 7
- 418
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... and w and were subsequently refined by varying /, w angles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10° Each /, h, and w-value was fixed by applying a harmonic potential and ... peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried out at 22 °C with either ... chain of b-HAla exhibits the same orientation as the one in [Ala9]SP (CIP’s rule a- amino acid: S configuration, thus (R) for b2-HAla and (S) for b3-HAla) (CIP, Cahn–Ingold–Prelog.) stabilized as...
- 11
- 860
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in Section 3 Influences of laser parameters ... Hoang, M.H Hanh / VNU Journal of Science, Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two- mode random microlaser, the variation of laser parameters ... parameters influences clearly on the transformation of mode photon densities With each parameter, its influence on two modes almost is inverse The increase of photon intensity of one mode makes...
- 4
- 343
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008