priming expansion and generation of memory glycolipid specific t cells
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... based on the maturation or activation state and the subset of DCs, and cytokine profiles in the microenvironment at the time of antigen uptake [1,14-16] A previous study demonstrated that CD11c+CD11b+ ... 0.05) Without CII stimulation, 1-MT had no significant effect on T- cell proliferation in either group To investigate the effect of IDO on the suppression of antigenspecific T cells exerted by ... Demonstrating the concomitant induction of IDO enzymatic activity by DCs, our data support IDO-dependent mechanisms that have been associated with induction of T- cell tolerance and immune inhibition...
- 10
- 473
- 0
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
... Forward Tar: 5'-GCAATGATGTCGTAATTTGC and 2, Reverse Tar: 5'-CTTGCTCAGTAAGAATTTTCGTC HIV-1 infection of thymocytes Thymocytes derived from thy/liv grafts of SCID-hu mice were sorted by FACS to enrich ... region of the transactivation response element (Tar), present at the 5'-end of all HIV-1 transcripts [1] In the absence of Tat, only short ineffective transcripts are generated Tat is also known to ... injected directly into thy/liv grafts for reconstitution Eight to ten weeks post reconstitution, thus allowing for T cell differentiation, the animals were sacrificed and thymocytes were isolated...
- 11
- 264
- 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc
... CaNDR1-BglII 5’-TCAGATCTTATGGACAAAGGATGGGGC-3’, and CaNDR1-BstEII 5’-TAGGTCAC CAAATTAATTCCCAGGAAA-3’ Digested PCR products were then ligated into the binary vector to get the final construct To test the ... mass of about 48 kDa instead of the predicted 24.6 kDa These authors further demonstrated that the protein regains its theoretical size when translated in vitro without the machinery dedicated ... delivered into coffee cells, H vastatrix effector proteins, and the intracellular perturbations that they trigger, are supposed to be perceived by specific R-proteins The recognition step promotes the...
- 17
- 455
- 0
Báo cáo y học: " Expansion of CD4+CD25+ helper T cells without regulatory function in smoking and COPD" potx
... into a cytotoxic phenotype This further supports a potential involvement of the acquired immune response in the pathogenesis of COPD To further evaluate the role of regulatory T cells in COPD and ... may reduce the proportion of these cells but this has to be confirmed in longitudinal studies These data therefore indicate the expansion of a T cell population without a regulatory function, which ... who maintain normal lung function, it has been implied that the upregulation of regulatory T cells would restrain cigarette smoke-induced inflammatory activation and, thus, the development of COPD...
- 8
- 302
- 0
Báo cáo y học: " A murine leukemia virus with Cre-LoxP excisible coding sequences allowing superinfection, transgene delivery, and generation of host genomic deletions" pptx
... ctgggtggcccaatcagtaagtccgagtc Akv-2XY Akv-Y a SfuI SpeI Env-aagttcgaa-LoxP-actagtgcggccgtttagtgaataaaagattttattcagtttacagaaagagggggg-3’LTR Env-aag attttattcagtttacagaaagagggggg-3’LTR ... infected with new virus) The other bands on the gel represent the fragment containing part of the 5' LTR and the adjacent host genomic DNA, with each band marking a unique integration site Due to ... since infected cells constantly produce envelope protein (Fig 2) Consistent with this notion, the http://www.retrovirology.com/content/1/1/5 intensity of EYFP fluorescence of the infected cells was...
- 14
- 210
- 0
Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues
... uses that range from antitussive to antiparasitic activity The oxidative cyclization of tyrosine was incorporated into the syntheses of several natural products, and the extension of this methodology ... produce potent thioredoxin/thioredoxin reductase (Trx/TrxR) inhibitors, and demanded creative synthetic solutions to the structural challenges Mother Nature provided The first pursuit was the total ... Two transition states were proposed (18 and 19) that could account for the observed diastereoselectivity (Figure 1.5) The diastereoselectivity was attributed to the minimization of allylic strain...
- 289
- 518
- 0
Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection
... suggestion that the ability of the innate immunity to produce large amounts of IFN-γ or Th1 cytokines might influence the activation of the adaptive immunity and determine the eventual likelihood of ... present different sets of peptides 68, 69 is another important contributor of the distinct epitopes targeted in HBV patients expressing different HLA-A2 subtypes In addition to the alterations ... 36 specific CD8 T cell repertoire of ethnically different patients and questions, at least in the context of HLA-A2 allele, the ability of the supertype motifs to predict virus -specific CD8+ T...
- 108
- 336
- 0
Fabrication and characterization of memory devices based on organic polymer materials
... Effect of read cycles on the ON state and OFF state 75 Figure 3.9: Ratio of the ON- to OFF-state current as a function of applied voltage 75 Figure 3.10: (a) Transient response of current density ... current Ioff off current J current density k Boltzmann constant K stability constant l empirical parameter Nv density of states q elementary charge T temperature V voltage ε relative dielectric ... Chapter 1: Introduction The easiest and more compact solution is the integration of one diode in series with the cell, at least for the resistive type of memories, and the use of intermediate...
- 132
- 434
- 0
Generation of porcine induced pluripotent stem cells and their differentiation into cardiac lineages
... 2.5hours This is to arrest the growth cycle of the cells and to mitotically inactivate them This prevents the cells from competing for nutrients with the hESCs After the treatment, the cells were ... system This vector constitutively expresses the ‘reverse tetracycline transactivator (rtTA)’ After the reprogramming factors as well as the rtTA vector have been introduced into the somatic cells, ... groups that were 34 not able to culture their porcine IPS cells on Matrigel™ The culture of the cells on Matrigel™ coated plates and on gelatin coated plates resulted in differentiation (Gao et al.,...
- 108
- 404
- 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf
... polar and electrostatic interactions including the Thr160 phosphorylation site In contrast, activation of Cdk5 is postulated to result from a repositioning of its T- loop by interactions between the ... p25 and tau (B) Total tau and phospho-tau were analyzed by Western blot using anti-tau (bottom) and phospho-tau S202 (top) Ig in aliquots of the same cell lysates Left lane, cotransfected with ... together the N- and C-terminal ends of the activating domain of p35 and confer the required rigidity This suggests an explanation for the increased affinity of CIP relative to the activating peptides...
- 8
- 329
- 0
Báo cáo toán học: "Expression and function of micro RNAs in immune cells during normal or disease state" pptx
... different not only between hematopoietic and non-hematopoietic cells but also within the hematopoietic group Both reports are the first to show that miRNAs are implicated in the commitment of hematopoietic ... first reports suggesting that although miRNAs negatively regulate the translation of target transcripts it is possible that they might enhance in specific instances translation A later publication ... on the molecular mechanisms or cellular settings that promote the enhancement of translation by miRNAs and what are the elements that make this switch Thai et al., [17] also demonstrated that...
- 7
- 260
- 0
Báo cáo y học: "Use of HLA-B27 tetramers to identify low-frequency antigen-specific T cells in Chlamydia-triggered reactive arthritis" docx
... secreting CD8+ T cells after antigen -specific stimulation These results show clearly that HLA-B27 tetramers have the advantage of detecting antigen -specific T cells independently of their cytokine-secreting ... not bind synovial T cells in this patient (not shown) The specificity of this staining could be confirmed by an increased quantity of tetramer-positive T cells after peptide -specific T cell stimulation ... possibility of sorting unstimulated T cells and of having a tool for the antigen -specific detection of T cells in experiments in situ [17] synovial proliferation against enterobacteria We also tested...
- 14
- 343
- 0
Báo cáo y học: "Use of soluble MHC class II/peptide multimers to detect antigen-specific T cells in human disease." pps
... apoptosis of the target T cells Other clinical situations, such as infection, cancer, and transplantation, will also be amenable to study with these multimers, although with the same limitations ... [15,16] The term ‘multimer’ is therefore preferred The extent of multimerization that allows for optimal binding to TCR but maintains specificity is unknown Staining T cells with MHC class II/peptide ... virus -specific CD4+ T cells is likely to be much lower than that of virus -specific CD8+ T cells The first use of peptide/MHC class II multimers to detect autoreactive T cells in human autoimmune...
- 5
- 455
- 0
Báo cáo y học: " Early detection of Varicella-Zoster Virus (VZV)-specific T-cells before seroconversion in primary varicella infection: case report" potx
... VZV -specific CD4+/ IFNg+ T- cell titers were highest at day two p.r.o and before the occurrence of seroconversion At this time, titers of up to 1% of total CD4+ T- cells were detected Such elevated ... with VZV-IgG titers of 2.2 IU/l and VZV-IgM titers of 1:160 VZV -specific CD4+ T- cells titers decreased to 0.19% when stimulating with VZV lysate, and 0.17% when stimulating with recombinant gE ... the Editor-in-Chief of this journal Additional file 1: Protocol for the detection of VZV -specific T- cells: This additional file provides a detailed protocol for the detection of VZVspecific T- cells...
- 3
- 353
- 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
... the up-regulatory effect of NF-κB with regard to HIV-1 transcription and the potent induction of this transactivator by TLR2 stimulation, we thought that the TLR2-mediated augmentation in de novo ... of the IFNα/β-inducible ISG54 promoter Stimulation of these cells with type-I IFNs activates the JAK/STAT/ISGF3 pathway and induces subsequently the secretion of SEAP in the supernatant A standard ... beginning to study the putative effect(s) of bacterial products that can bind TLRs in DCs in the context of HIV-1 infection [30,31] It has been recently reported that productive HIV-1 infection of immature...
- 16
- 288
- 0
Báo cáo y học: " The influence of oxygen tension on the structure and function of isolated liver sinusoidal endothelial cells" potx
... contributions IM and BS conceived of the study IM carried out most of the experimental work and the writing AW and DGL participated in the determination of fenestration parameters, statistical ... results demonstrate a faster decay of loss of cells in cultures maintained at hyperoxic conditions Statistical analyses by t- student test: *P < 0.05, **P < 0.001 In this study, we demonstrate that ... metabolic routes of cells, most commonly shifting from the oxidative phosphorylation pathways to the glycolytic routes Morphometric studies of LSECs in the intact liver have shown that the cells...
- 11
- 435
- 0
Engineering and characterization of human renal proximal tubular cells for applications in vitro toxicology and bioartifical kidneys
... 5'-GGGATTTAGAACCTGCATCT-3' GLUT5 / SLC2A5 F 5'-CCCCAGCTCTTCATCACTGTTGGC-3' 148 R 5'-TTTGGAACACAAGGAGGGGGCC-3' OAT1 / SLC22A6 F 5'-TCTACTCCTGGTTCTTCATTG-3' 142 R 5'-CGGAGTACCTCCATACTCAAT-3' OAT3 / ... 5’-TTTCAGGAATTGTGCATCCATAA -3’ TGF-β1 F 5’- ACCTGAACCCGTGTTGCTCT-3’ 128 R 5’-GCTGAGGTATCGCCAGGAAT-3’ PDGF-A F 5’- TTGGCCACCTTGACGCT-3’ 224 R 5’- CCTGCCCATTCGGAGGAA-3’ PDGF-B F 5’- TTTCTCACCTGGACAGGTCG-3’ ... 5'-ACCTGAGGGAAACTAATCTG-3' 105 R 5'-CGTTGATAACCTGTCCATCT-3' MDR1 / ABCB1 F 5’-GCCCTTGTTAGACAGCCTCATATTT-3’ 141 R 5’-GGACAGGCGGTGAGCAAT-3’ GAPDH / GAPDH F 5’-TTGACGCTGGGGCTGGCATT-3’ 157 R 5’-GTGCTCTTGCTGGGGCTGGT-3’...
- 129
- 488
- 0
Mathematical modeling and analysis of organic bulk heterojunction solar cells
... mobility Set et al [73] employed transient modeling to study the e ects of degradation-related trap states and trap-assisted recombination on the measured Intensity-Modulated Photocurrent Spectra ... concentration) that occurs between the bound electron and hole in the charge-transfer state; therefore it prevents the production of free electrons and holes The rate of geminate recombination ... characteristics explicitly with the charge carrier generation rate This exciton transport model can be directly incorporated into the spatially-smoothed model, allowing it to capture the e ects of...
- 147
- 606
- 0
Fabrication and optimization of flexible dye sensitized solar cells
... to the substrate, the Ti substrates are first sintered in air for the growth of a layer of native oxide Using a sputtered semi-transparent Pt cathode, the devices are illuminated from the cathode ... used substrate for DSSCs as it is highly conducting, sintering resistant and transparent, but it is rigid, brittle and heavy These limitations restrict the application of devices on flat rigid ... spectroscopy (EIS) is a steady-state technique that measures the current response to the application of an ac voltage as a function of the frequency This allows the analysis and understanding of...
- 137
- 276
- 0
Wheat germ agglutinin conjugated poly dl lactic co glycolic acid (PLGA) nanoparticles for enhanced uptake and retention of paclitaxel by colon cancer cells
... chemotherapy Microtubules are filamentous polymers that constitute one of the major components of the cytoskeleton They are a superb target because of their important function in mitosis and cell ... molecule to cause strand breaks or premature chain termination; antibiotic cytotoxic agents that alkylate DNA or inhibit topoisomerase II or both; spindle poisons that bind to tubulin to inhibit tubulin ... putting up with all my frustration and emotion during the journey of my study all along I TABLE OF CONTENTS Content Page ACKNOWLEDGEMENTS Ⅰ TABLE OF CONTENTS Ⅱ SUMMARY II LIST OF TABLES II LIST...
- 231
- 349
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu