primary care in search of a clinician for all seasons
Báo cáo y học: "Cyclophosphamide in systemic sclerosis: still in search of a ‘real life’ scenario" potx
... 1.5 years) and 0.44 QALYs if started after years from the diagnosis [9] These data clearly demonstrate that an early diagnosis of ILD in SSc is fundamental for starting a treatment that may ameliorate ... associated with a greater preservation of lung function and that it allowed a gain of 0.20 qualityadjusted life years (QALYs) versus a loss of 0.21 QALYs of the case base (disease duration of 1.5 ... withdrawals in the active group due to side effects (1 patient had intolerable nausea and patient had abnormal findings on liver function tests during treatment with AZA) and no withdrawals in the...
- 3
- 301
- 0
In search of good predictors for identifying effective spaced seeds in homology search
... Department of Statistics and Applied Probability of National University of Singapore I have learned many things from him, especially regarding academic research and character building I truly appreciate ... staff of the department for their help in various ways and providing such a pleasant working environment, especially to Jerrica Chua for administrative matters and Mrs Yvonne Chow for advice in ... on translations, tandem and segment duplications can be easily inferred It is usually done by aligning them using dynamic programming approach (Needleman and Wunsch [1970], Smith and Waterman [1981])...
- 84
- 100
- 0
A brand for all seasons? A discussion of brand loyalty approaches and their applicability for different markets
... Attitudinal Attitudinal Behavioural Attitudinal Attitudinal Attitudinal Behavioural Behavioural Table I The measures involved, ``attitudinal'' or ``behavioural'', in brand loyalty Downloaded by MAHIDOL ... summarises and acknowledges the variety of approaches to brand loyalty Second, it offers an explanation for the variety and the lack of a single best approach to defining and measuring brand loyalty ... Journal of Product & Brand Management 23:4/5, 322-332 [Abstract] [Full Text] [PDF] Farzana Quoquab, Norjaya Mohd Yasin, Rozhan Abu Dardak 2014 A qualitative inquiry of multi-brand loyalty Asia Pacific...
- 15
- 472
- 0
báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc
... The authors are grateful to the AOK Sachsen-Anhalt and the AOK Rheinland-Pfalz for support in sending out the study material to their insured and for the preparation of claims data for sampling ... female) a random sample of 3546 patients (59,3% female) was drawn All participants were patients with type diabetes and insured by one large statutory regional health care fund called Allgemeine ... questionnaires in order to assure confidentiality Based on sociodemographics out of routine claims data of the statutory health insurance we performed a nonresponder analysis including age and gender of all...
- 7
- 458
- 0
báo cáo khoa học: "Task shifting and integration of HIV care into primary care in South Africa: The development and content of the streamlining tasks and roles to expand treatment and care for HIV (STRETCH) intervention" ppt
... below Standard of care training in all clinics Since 2005, the Free State Department of Health has been running a regular two-week ART training course for staff in ART and other primary care clinics ... therefore also used to impart basic skills for trainers to debrief nurses The Table Characteristics of various nurse trainings available as standard of care in all ART and primary care sites compared ... State ART training programme alongside • Teaching in the Free State ART training programme ART programme doctors alongside ART programme doctors • Available for clinical advice for all staff in ART...
- 11
- 497
- 0
IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT) VIETNAM NATIONAL UNIVERSITY, HANOI
... systematic training program The lack of an overall foreign language policy can give way to spontaneous and inconsistent application of the teaching and learning of the language Moreover, administrators ... native teachers are normally appreciated According to the international language centre called Language Link based in Russia, if a good teacher should understand the intricacies of the language ... Communicative Language Teaching (CLT), an appropriate approach in Teaching and Learning English in VNU 1.2.2.1 The Nature of CLT 1.2.2.2 Advantages of CLT 1.2.2.3 CLT - An Appropriate Approach at...
- 88
- 675
- 1
Tài liệu Men’s knowledge and awareness of maternal, neonatal and child health care in rural Bangladesh: a comparative cross sectional study pptx
... Dhaka: BRAC; RED Working Paper No 26 31 Nuraini E, Parker E: Improving knowledge of antenatal care (ANC) among pregnant women: a field trial in central Java, Indonesia Asia Pacific Journal of ... mortality in Bangladesh in mind, BRAC has initiated a large communitybased programme to reduce maternal, neonatal and child mortality in 2005 in Nilphamari and has taken a decision to scale up in ... Joint decision-making was less common in the control areas for all types of care (Figure 2) Transitional areas Data from the transitional areas were included in the study because it acts as a...
- 9
- 722
- 0
Tài liệu Non-blood medical care in gynecologic oncology: a review and update of blood conservation management schemes docx
... He reinfused 400 ml of salvaged blood into a 58-year-old woman operated for ovarian adenocarcinoma and 170 ml of salvaged blood into a 49-year-old female operated on for a large pelvic mass, ... accompanying the method are fat and air embolism and infection [4] Aminocaproic acid, desmopressin acetate, aprotinin, tranexamic acid, phytonadione and vasopressin are hemostatic drugs also utilised ... MEDLINE research; FZ: assisted in writing the manuscript, made MEDLINE research, submitted the manuscript; AV: made MEDLINE research; NA: made MEDLINE research; DZ: made MEDLINE research; CP: made...
- 6
- 625
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢);...
- 14
- 473
- 0
ORGANIZATION OF CARE IN PSYCHIATRY OF THE ELDERLY: A TECHNICAL CONSENSUS STATEMENT pptx
... training in relation to the management of these disorders The participation of international organizations such as the International Psychogeriatric Association, Alzheimer's Disease International, ... assessment or specialist referral) A diagnostic formulation is important both to allow rational care planning and to inform patients and carers as to the current situation, management options and outlook ... Prophylactic treatment may play an important role The primary goal of management is, as far as possible, to maintain or improve the quality of life of patients and their carers while respecting...
- 19
- 493
- 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
... HNE and AMA are shown for porcine (C) and bovine (D) OBP Protein samples were incubated with a fixed saturating amount of AMA and increasing HNE Each point on the y-axis shows the concentration of ... 16-h incubations, in which at least 50% of residual ligand-binding capacity was maintained at the highest [HNE] ⁄ [OBP] values In the case of 20-min incubations, HNE inactivation was even less ... protein was realized as reported above for the recombinant forms of porcine and bovine OBP The purification of the protein was obtained by affinity chromatography with a Ni-NTA Agarose (Qiagen,...
- 12
- 386
- 0
báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx
... 283–294 Kayongo M, Rubardt M, Butera J, Abdullah M, Mboninyibuka D, Madili M: Making EmOC a reality – CARE' s experiences in areas of high maternal mortality in Africa International Journal of Gynaecology ... 96:220-225 Clapham S, Basnet I, Pathak LR, McCall M: The evolution of a quality of care approach for improving emergency obstetric care in rural hospitals in Nepal International Journal of Gynaecology ... affect the availability of HR for EmOC They point out that these staff shortages weaken the quality of care by increasing professionals' workloads and patients' waiting times and making infection...
- 12
- 640
- 0
báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf
... revisiting underlying assumptions and providing alternative explanations (summarised in Table 1) for observations advanced - Page of 20 and maintained - as key by advocates of the hypothesis, adding ... mouse models that the paracrine c-kit/SCF signaling pathway is crucial for activation of primordial follicles, oocyte survival and growth, and maintenance of meiotic arrest in small antral follicles ... precursor of haematopoietic and endothelial lineages, occurs in a temporally and spatially defined manner It is a mesodermal derivative of transient existence, arising within the length of the posterior...
- 20
- 407
- 0
in search of memory the emergence of a new eric r kandel
... provinces contained Hungary, Croatia, and Bosnia After the war, Austria was drastically reduced in size, having lost all of its foreignspeaking provinces and retaining only the German-speaking core ... very beginning in the 1920s, the agenda of the Nazi party, which was framed in part by Austrian Nazis, included the merger of all German-speaking people into a Greater Germany In the fall of 1936 ... him as an upstanding man of integrity and character is specifically mentioned by an officer of the Kultusgemeinde in his evaluation of my fathers request for assistance MY LAST YEAR IN VIENNA WAS...
- 319
- 333
- 0
Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps
... 118) state that "one advantage of finding stable parameters lies This transformation is made for this practical reasons but, being univariate, it has essentially no effect on the precision and on ... with a data set containing 44 trees belonging to 13 good growing stands, sampled in the Landes de Gascogne area and aged more than 35 years to get the main part of the curve This selection was made ... functions of each estimated parameter, evaluated at each observed time If the sensitivity functions of parameproportional on a given sampling interval, the parameters have essentially the same effect...
- 10
- 280
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... particular individuals in a stand Sap flow data have been used for estimating hourly transpiration and canopy conductances in a range of forest stands [1, 10, 13, 19, 20] The sap flow measurements can ... temperature and transpi- a crown ration rate; the resistance and capacitance of each compartment are independent of the flux or water potential of the compartment and remain constant during the day ... on each site ’upscaled’ the sap flux values from tree to stand using optically determined leaf area index values (table I), assuming the needles had a semi-cylindrical shape, and calculating...
- 18
- 406
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG ... protein Statistical analysis Data are reported as mean ± standard deviation (SD) of replicate mean values for separate patient cell cultures However, because of interindividual variation, data in...
- 10
- 438
- 0
Báo cáo y học: "In search of traditional bio-ecological knowledge useful for fisheries co-management: the case of jaraquis Semaprochilodus spp. (Characiforme" ppsx
... IBAMA: Estatớstica Pesqueira Amazonas e Parỏ - 2003 Manaus: IBAMA/ ProVỏrzea; 2006 Batista VS: Biologia e administraỗóo pesqueira de alguns Caraciformes explotados na Amazụnia Central In Professor ... (Zungaro zungaro) and surubim (Pseudoplatystoma spp.) Piranha (Serrasalminae), tucunarộ (Cichla spp.) and pirarucu (Arapaima gigas) are also examples of other fish that feed on jaraquis during all ... related to similar ones already available in scientific literature evaluating the association of themes to information Results of fisherman types were also compared, allowing an initial evaluation...
- 9
- 266
- 0
báo cáo khoa học: "From PALSA PLUS to PALM PLUS: adapting and developing a South African guideline and training intervention to better integrate HIV/AIDS care with primary care in rural health centers in Malawi" pot
... to rural primary care centers [1,6] However, scaling up access to ART and other health services while maintaining quality of care is a challenge given major shortages of trained healthcare workers ... trainers, and increased confidence in integrating HIV/AIDS care with primary care [17,18], potentially important factors for improving staffing and strengthening the healthcare system PALSA PLUS ... representatives of Malawian professional associations, clinicians working in primary and secondary care in Malawi, and representatives of DI The second phase involved a detailed review of the most...
- 10
- 273
- 0
A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot
... South Australia Adelaide; 1999 Australian Institute of Health and Welfare (AIHW): Diabetes management and the allied health workforce: An overview of workforce mapping techniques and related data ... knowledge of clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy ... websites including: ▪ Agency for Healthcare Research and Quality National Guideline Clearinghouse, USA; 2,097 guidelines, as at 27th June 2007 ▪ NHMRC, Australia; 46 guidelines as at...
- 9
- 486
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25