president with his wife and daughter is returning from a brief vacation at sun valley in order to attend to press conference this afternoon
Báo cáo y học: "Protease inhibitor-induced nausea and vomiting is attenuated by a peripherally acting, opioid-receptor antagonist in a rat model" doc
... on kaolin intake induced by ritonavir in rats Effects of pretreatment with naloxone on kaolin intake induced by ritonavir in rats Ritonavir-induced increase in kaolin intake was attenuated with ... called pica behavior Pica in rats is thus analogous to nausea and vomiting in humans and other species [11,13] Pica in rats is mediated by mechanisms and receptors involving serotonin and dopamine, ... of data, analysis and interpretation of the data, critical revision of the article, and final approval of the article SRM was responsible for the analysis and interpretation of the data, and critical...
- 8
- 320
- 0
báo cáo khoa học:" Differences in demographic composition and in work, social, and functional limitations among the populations with unipolar depression and bipolar disorder: results from a nationally representative sample" ppt
... concerning bipolar disorder, are largely absent The goals of this study are 1) to assess the demographics of mood disorder populations at a national level, and 2) to measure the distinct societal and ... mood disorder A second implication is that, due to the relative disadvantages among the bipolar disorder population vis-à-vis demographics and circumstances, individuals with bipolar disorder may ... of findings and discussion JM participated in drafting the manuscript, data collection, and statistical analyses JZ participated in the design, completed analyses, and helped draft the manuscript...
- 9
- 328
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... chinh phục vùng đất ph a Nam bàn tay khối óc mình, cần cù, lam lũ: “Họ to n tiên phong vũ trang óc phiêu lưu mạo hiểm, cán b a, lưỡi cày, lưới ” [59; 60] Hoặc “Nam Kì chinh phục gươm vó ngựa...
- 137
- 853
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
... 5¢-AGCATAACTGGAACGTGGG-3¢ for caerin 1.12, 5¢-CAGCAATAAGTGGAACAACG-3¢ for caerin 1.13, 5¢-GTGTTTAGCAACGGATTTACC-3¢ for caerin 1.14 and 5¢-AGCAACGGATCCTAGGA CAC-3¢ for caerin 1.15 The temperature ... on isolated India between 150 and 65 Ma and colonized the Laurasian land mass after India collided with Asia Abbreviations; AF, Africa; IND, India; AUS, Australia; SA, South America; ANT, Antartica ... antimicrobial peptides from South American hylids [32,34–37] and Asian, European AMWKDVLKKIGTVALHAGKAALGAVADTISQa GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa ALWKNMLKGIGKLAGQAALGAVKTLVGAE ALWKDILKNVGKAAGKAVLNTVTDMVNQa...
- 14
- 305
- 0
báo cáo khoa học: "Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report" pdf
... Fatal septicemia in a patient with cerebral lymphoma and an Amplatzer septal occluder: a case report Claudia Stöllberger1*, Adam Bastovansky1 and Josef Finsterer1,2 Addresses: 1Krankenanstalt ... was complicated by a non-Hodgkin lymphoma and probably by chemotherapyinduced Evans syndrome Symptomatic atrial fibrillation was diagnosed 58 months after implantation, and a therapy with bisoprolol ... bacteria This hypothesis is substantiated by histological findings of explanted SOs, showing a chronic inflammatory reaction inside the occluder [7] In our patient, who already had experienced an...
- 10
- 247
- 0
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx
... aaaaagcaggctccatggattctcaggaca TSPO NT2 aaaaagcaggctccatggccgagacagagagg TSPO NT3 aaaaagcaggctccatggcgaaacgtggtctc TSPO CT1 agaaagctgggtccgcgacagcaagctttaca TSPO CT80 agaaagctgggtcggacttagctcgattcccgta Balsemão-Pires ... cloning and genotyping PRIMER NAME FOR GENOTYPING AND CLONING SEQUENCE AtTSPO LP agagcaaatcgcatcagcgtc AtTSPO RP ggaacgtaaccggatcccaaa LBa1 tggttcacgtagtgggccatcg TSPO NT1 aaaaagcaggctccatggattctcaggaca ... AGGAGCCATACATTCTCTCT GUN2 FWD AGACTCCAATTTCCCAACTT GUN2 RVS TTACCAGGACGTGTTGGTTC GUN4 FWD GAAACCGCGACCATATTCGAC GUN4 RVS CGGCTTCTCCGGATATCTGAA GUN5 FWD CATCCACTTGCTCCAACCATG GUN5 RVS CCGACAACCGTTGCATCTTT...
- 17
- 368
- 0
Báo cáo y học: " Caseous calcification of the mitral annulus with mitral regurgitation and impairment of functional capacity: a case report" doc
... the drainage (Figures 1b and 2b) Trivial mitral regurgitation was seen (Figure 3b) The patient was discharged after seven days with symptomatic improvement and was sent to a rehabilitation facility ... information regarding the internal area of the mass, and cardiac fast CT, magnetic resonance imaging or single photon emission CT could also be useful However, in some cases an intramyocardial ... calcification and its location at the mitral-aortic fibrosa, sometimes with systolic flow in the cavity visualized by colour Doppler, are characteristics of a mitral abscess CCMA is not a malignant...
- 4
- 344
- 0
Báo cáo y học: " Midlife diagnosis of Refsum Disease in siblings with Retinitis Pigmentosa – the footprint is the clue: a case report" pot
... 70(2):178-186 Eldjarn L, Stokke O, Try K: Alpha-oxidation of branched chain fatty acids in man and its failure in patients with Refsum's disease showing phytanic acid accumulation Scand J Clin Lab Invest ... neurological features RD, Bassen-Kornsweig syndrome, vitamin E deficiency, and gyrate atrophy are examples of conditions within this group that are amenable to dietary modification that can influence ... soon as the diagnosis is made Conclusion RD is a potentially lethal and disabling disease, which is amenable to treatment Brief neurological screening [15] and smell testing [7] of patients with...
- 4
- 356
- 0
báo cáo khoa học: " Identification of genes associated with growth cessation and bud dormancy entrance using a dormancy-incapable tree mutant" doc
... 5’-ATGGCAAACCACCAAGCACTCA-3’ R 5’-GTAGAGGAGCCTTGATTGGAGGAG-3’ Unknown3 GE653309 F 5’-AAGTTGTCCATCCCAACACATTCG-3’ R 5’-GCGAGGACATCTCTGGCAATAAGA-3’ Unknown4 GE653307 F 5’-TCCTCAACGAACAGACGGAACTC-3’ ... 5’-CCAGAGAAATTATGGAAGCCCCA-3’ Dormancy associated MADS-box gene (PpDAM6) GE653238 F 5’-CCAACAACCAGTTAAGGCAGAAGA-3’ R 5’-GGAAGCCCCAGTTTGAGAGA-3’ Epicotyl-specific tissue protein GE653203 F 5’-CACCAAAAGAGAAAGCCGACTGC-3’ ... 5’-CACCAAAAGAGAAAGCCGACTGC-3’ R 5’-TCAACCTCAACGTCAACCTCAAC-3’ RD22 (dehydration-responsive) precursor GE653312 F 5’-GAACCCACACAAGATTATCAGCAGG-3’ Unknown2 GE653334 R F 5’-TTCTACTGCCACAGCCAGCA-3’ 5’-ATGGCAAACCACCAAGCACTCA-3’...
- 11
- 317
- 0
Báo cáo y học: " Greater risk of incident asthma cases in adults with Allergic Rhinitis and Effect of Allergen Immunotherapy: A Retrospective Cohort Study" ppt
... mites a monthly maintenance dose equivalent to at least 3.2 µg of Der and 1.6 µg of Der was reached Statistical analyses The data were analyzed with SAS-PC statistical package (SAS Institute, Cary, ... that ongoing exposure to Parietaria pollen is closely associated with inflammatory changes in the bronchial airways of subjects with allergic rhinitis, that may advance to clinical asthma Another ... Bronchial mucosal manifestation of atopy: a comparison of markers of inflammation between atopic asthmatics, atopic non-asthmatics and healthy controls Eur Respir J 1992, 5:538-44 Polosa R, Ciamarra...
- 11
- 296
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf
... the bathroom is large How are brands built? It’s a mistake to think that advertising builds the brand Advertising only calls attention to the brand; it might even create brand interest and brand ... today most advantages don’t stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another ... managed Here is his plaint: “Brands not have to die They can be murdered And the marketing Draculas are draining the very lifeblood away from brands Brands are being bargained, belittled, bartered...
- 226
- 1,421
- 7
Evaluation of employees’ job satisfaction and role of gender difference an empirical study at airline industry in iran
... satisfaction may decrease From this, it is likely that job satisfaction decreases when career advancement is limited It is therefore imperative that top managers pay special attention to this ... and co-workers that contain statements related to each measured factor By using the Likert-type scale ranging from very dissatisfied=1, dissatisfied=2, sometimes not satisfied or sometimes satisfied=3, ... domain of job satisfaction is too broad, since it involves the job and its environment characteristics Thus, in order to manage the broadness and obtain measures of job satisfaction two approaches...
- 11
- 591
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 1
... the bathroom is large How are brands built? It’s a mistake to think that advertising builds the brand Advertising only calls attention to the brand; it might even create brand interest and brand ... managed Here is his plaint: “Brands not have to die They can be murdered And the marketing Draculas are draining the very lifeblood away from brands Brands are being bargained, belittled, bartered ... of advertising.”8 rands Everything is a brand: Coca-Cola, FedEx, Porsche, New York City, the United States, Madonna, and you—yes, you! A brand is any label that carries meaning and associations...
- 15
- 603
- 1
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 10
... Marketing Insights from A to Z • From mass marketing to customized marketing The mass market is splintering into mini-markets and your company now has the capability of marketing to one customer ... companies believe they can make a greater return • From operating in the marketplace to operating in cyberspace Smart companies are developing a presence online as well as off-line They are using ... one customer at a time • From owning assets to owning brands Many companies are beginning to prefer owning brands to owning factories By owning fewer physical assets and outsourcing production,...
- 26
- 571
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 2
... today most advantages don’t stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another ... popularized the notion that a company wins by building a relevant and sustainable competitive advantage.17 Having a competitive advantage is like having a gun in a knife fight This is true, but today ... determined So Caterpillar has been able to launch Cat jeans, sandals, sunglasses, watches, and toys, all designed with the same traits in mind A strong corporate brand needs good image work in terms...
- 20
- 636
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 3
... Satisfaction Most companies pay more attention to their market share than to their customers’ satisfaction This is a mistake Market share is a backwardlooking metric; customer satisfaction is a ... learned 41 42 Marketing Insights from A to Z that its leading competitor attained a 90 percent customer satisfaction score The company was further dismayed to learn that this competitor was aiming ... more surprises and delights can a company create? Interesting question! atabase Marketing At the heart of CRM is database marketing Your company needs to develop separate databases on customers,...
- 21
- 567
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 4
... image and emotional marketing to win customer mind share and heart share Although this has gone on from the beginning of time, today it is accelerating The old marketing mantra advised companies ... customer through a memorable experience inancial Marketing I have always urged marketers to be strong in financial thinking This is not a natural inclination of marketers They are marketers because ... understand the marketing process and what it takes to win They know that advertising, sales promotion, and other marketing initiatives are necessary Their task is to make sure that the money is spent...
- 20
- 617
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 5
... this information This has led to an explosion of interest in knowledge management: organizing a company’s information so that it is easily retrievable and learning can be extracted from it Many ... have to streamline and integrate their data into a single data system Marketing is becoming more based on information than on brute sales power Thanks to the computer and the Internet, no salesperson ... takes credit, pointing instead to his great team, and he pins his success on being “lucky.” Katherine Graham of The Washington Post was another quiet leader who built a great newspaper into a...
- 20
- 574
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 6
... Marketing Insights from A to Z Building loyal customers requires a company to discriminate We are not talking about racial, religious, or gender discrimination We are talking about discriminating ... than to understand customers’ needs or wants • Data mining Companies with large customer databases can use statisticians to detect in the mass of data new segments or new trends that the company ... communications Later, marketing gathered information to estimate market potential, assign sales quotas, and develop sales forecasts Salespeople often have complained about marketing setting sales...
- 22
- 557
- 0
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB - phần 7
... cars, and in elevators, bathrooms, and next to gas pumps Yet as ads proliferate, they are in danger of being less noticed Your media efficiency can be greatly enhanced by moving toward database marketing ... become a virtual organization Yet a company may go too far in outsourcing What makes a great company is that it has created a set of core competencies that link ingeniously and would be difficult to ... for each industry a single senior-level manager to have authority and accountability to orchestrate interdivisional cooperation regarding each industry utsourcing Your company can be great at only...
- 21
- 591
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25