... Fep1p regulation in S pombe, including novel regulatory targets Details are given in the text Fep1p Fep1p * attacaTCTGATAActTTTGTCcagattgGTAGA TAAgcaa taatgtagactattgaaaacaggtctaaccatct attcgtt ... Metallothioneins Catalase A, peroxisomal and mitochondrial Catalase T, important for free radical detoxification Cu/Zn superoxide dismutase Cell wall mannoprotein 3-ketoacyl-CoA; beta-oxidation of fatty acids ... The Atf1 transcription factor is a target for the Sty1 stress- activated MAP kinase pathway in fission yeast Genes Dev 1996, 10:2289-2301 Yamada K, Nakagawa CW, Mutoh N: Schizosaccharomyces pombe...
... (plaintain) Spinacia oleracea (spinach) Nicotiana sylvestris (tobacco) Nicotiana sylvestris (tobacco) Evaluation Tissue leaf leaf leaf leaf leaf leaf leaf leaf root of Isolated RNA Absorbance ratio ... mRNA analyses including RT-PCR, can be performed starting with total cellular RNA, which is invariably easierto isolate and can be analyzedfor quality on an agarosegel prior to subsequentanalytrcal ... characteristic of inflammatory responses.RNA-based methods are currently used to monitor the responseto therapy of HIV and hepatitis C infections, and we can anticipate that a similar approach...
... was studied at different levels (day 1, day 2, day 3, day 4, day 5, day 6, day 7) This activity was carried out with triplicate Procedure: performed similar to activity 2.2.3 Incubate flasks at ... and temperature effects on keratinolytic activity of Bacillus pumilus K8 In particular, the activity of keratinase reached the highest value at 40oC, and also has the degradation of feather at ... the TCA toa reaction mixture before the addition of enzyme solution A unit of keratinase activity was defined as a 0.01 unit increase in the absorbance at 450 nm as compared to the control after...
... Qiaofang Zhong, Xianghua Tang, Yunjuan Yang and Zunxi Huang 2009 Isolation and characterization of a new keratinolytic bacterium that exhibits significant feather-degrading capability African ... Production and characterization of feather degrading keratinase from Bacillus sp JB 99 Indian Journal of Biotechnology Vol 9, pp 384-390 Mohammad Shahnoor Hossain, Abul Kalam Azad, S.M Abu Sayeni, Golam ... considered as a means of avoiding environmental pollution Traditional ways to degrade feathers such as physical and chemical treatments may not only destroy the amino acids but also consume large amounts...
... between January and March, while natural U pinnatifida plants maturated after spring (Taniguchi et al., 1981; Akiyama et al., 1982; Tokuda et al., 1987; Saitoh et al., 1999) Thus, prematurity and withering ... Percentage covers of algae and seagrass (%) Sargassum fusiforme Calliarthron yessoense Serraticardia maxima Corallina pilulifera Gigartinales Codium fragile Phyllospadix iwatensis Undaria pinnatifida ... Percentage covers of algae and seagrass (%) Sargassum fusiforme Calliarthron yessoense Sargassum horneri Grateloupia turuturu Phyllospadix iwatensis Undaria pinnatifida Crustose coralline algae Cladophora...
... tảo thành vi khuẩn ổn đònh Photograph: Dr Ponlert Chandratchakun Cách Cho n nh Hưởng Đến FCR FCR Variation at 174 farms in Thailand (Tacon 1993) 35 Percent of Farm s 30 25 20 15 10 1.0-1.2 1.2-1.4 ... 204 - - 3 Americas - - - - 147 180 225 271 332 Africa 10 - - - - - China 10 140 188 252 266 293 Thailand 300 280 240 120 80 - - 10 190 245 Malaysia 18 18 19 20 20 - - - - - Indonesia 94 104 113 ... Claude E Boyd, Auburn University - USA Vi Khuẩn Hấp Thụ Ammonia Bổ sung nguồn carbon hữu Mật rỉ đường Đường Vi khuẩn kết hợp ammonia carbon hữu để tạo protein cho Mật rỉ đường 20 kg/ha/ngày...
... BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; (31) Caspian Sea; (32) Gulf of Bothnia; (33) Gulf of Finland; (34) Sallvik ... GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 1994) were used to obtain sequences from COI Primer pairs 16SA2 (5Ј CCGGGT C/T TCGCTAAGGTAG) and 16SB2 (5Ј CAACATCGAGGTCGCAGTAA) were designed specifically ... rate of approximately 0.9%/million years in 16S rRNA, calibrated for fiddler crabs (Uca vocator; Sturmbauer et al 1996) and Jamaican grapsid crabs (Sesarma; Schubart et al 1998) Similarly, separation...
... Finland E-mail: sonata.vysniauskaite@helsinki.fi ABBREVIATIONS ADA American Dental Association ANOVA Analysis of variances AAPD American Academy of Paediatric Dentistry CI Confidence interval ... dental visit is a common indicator to describe dental attendance (Nuttall 1997), and annual visits have been suggested as an acceptable indicator of appropriate use of dental care (Vargas et al ... dental services as children (Petersen et al 2004) The American Academy of Paediatric Dentistry (AAPD) and American Dental Association (ADA) underline the importance of prophylaxis’ application and...
... associates remarking that he was glad to set to work again, as it was "a long time since they had done any business in hands." On the same occasion a cutler was dealt with after a similar fashion ... class as to the inviolability of the privilege of highway plunder that a monk, preaching one day in a cathedral and happening to attack it as unjustifiable, narrowly escaped death at the hands ... out of date Plato was extolled at the expense of Aristotle Greek, and even Hebrew, was eagerly sought after Latin itself was assuming another aspect; the Renaissance Latin is classical Latin, whilst...
... (Pharmacia, Sweden) Final purification was carried out by HPLC on TSK-gel DEAE 2SW column (Toyo Soda, Japan) Labeling of tRNAPhe Yeast tRNAPhe was dephosphorylated with bacterial alkaline phosphatase ... is characteristic for hydroxyl radical-like agents, and in this case can be ascribed to the reactivity of an activated oxygen atom, bound at the copper atom coordinated to the Ami molecule All ... acid and ammonium carbonate: free Ami, Ami-H2O2, Cu(II)-Ami and Cu(II)-Ami-H2O2 All samples were prepared as water solutions and incubated at 37 °C for 5, 20 and 40 Then methanol was added to a...
... distant areas that are hard to access and usually restricted as they are private forestry property To this is added the workers scant organizational capacity as they usually work for small contracting ... ban Articles then appeared in major papers supporting paraquat as ‘Safe to Use in Agriculture’ and calling for a lifting of the ban and phaseout.” The Malaysian government decided to temporarily ... Pacific (PAN AP), referred toa situation which is hardly unique in the Malaysian oil palm sector: “Rajam worked as a pesticide sprayer on an estate earning a daily wage of RM18 The main pesticide...
... formula (39) In general, the boundary terms will also be present in other gauges, because their appearance is due to the facts that the Lagrangian contains second order derivatives and range of ... Integrating formula (21) over σ , and taking into account boundary conditions (14) we again obtain that ∂0 pµ = (22) This is a check that our formulae (21) and (22) are correct By a similar reasoning ... structure are rather complicated Hamilton description of the open rigid string Discussion of Hamilton formulation of dynamics of systems with reparametrization invariance, which is a special case of...
... conformations of guanines within a G-tetrad are geometrically associated with the relative strand orientations, being respectively: (a) anti•anti•anti•anti or syn•syn•syn•syn, (b) syn•anti•anti•anti ... Bianchi A, Moss H & de Lange T (1999) Mammalian telomeres end in a large duplex loop Cell 97, 503–514 72 Xu Y, Sato H, Sannohe Y, Shinohara KI & Sugiyama H (2008) Stable lariat formation based ... DNA J Am Chem Soc 129, 1502–1503 92 Kettani A, Gorin A, Majumdar A, Hermann T, Skripkin E, Zhao H, Jones R & Patel DJ (2000) A dimeric DNA interface stabilized by stacked A (G•G•G•G) A hexads and...
... 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc tagagacgtacagatgcgtctcacaggacacaaggcctgttactagcactcacatgg aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca ggccttgtgtcctgtgagacgcatctgtacgtctctagcatacagccttcagcaagcct ... ligated toa pair of oligos containing several restriction sites, 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacct attggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and 5¢-gtac cgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctat ... cgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctat ctggtccacgcgtatgcgatatcagcagctagcgccg-3¢, and pEGFP-N1 cut by NdeI and Acc65I, to generate pEGFP-N1-Intron pSM30 and pSM155 were then generated by...
... remarking that he was glad to set to work again, as it was "a long time since they had done any business in hands." On the same occasion a cutler was dealt with after a similar fashion The hands ... class as to the inviolability of the privilege of highway plunder that a monk, preaching one day in a cathedral and happening to attack it as unjustifiable, narrowly escaped death at the hands ... then did a man fill his belly and carry away withal as much as he could; then was wealth and plenty Otherwise is it now A costly and a bad time hath arisen since many a year, and the food and drink...