poly i c generates significantly higher frequency of e7 specific cd8 t cells compared to subcutaneous vaccination
Báo cáo y học: "Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients" potx
... prepared the manuscript SK, SA, MW and CB participated in the collection of clinical data and the recruitment of patients into the study UW and HH participated in the design of the study, statistical ... measurements, which makes it unlikely that conversion to RF positive and anti-CCP positive status could occur in carriers of the risk allele at later stages of the disease An interesting finding of the ... Arthritis Research & Therapy Vol No Pierer et al T cell activation process Possible pathogenetic mechanisms implied by this finding include failure to delete autoreactive T cells during thymic...
- 7
- 420
- 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the maximal tetramer + CD8+ response, ... numbers of hTERT -specific CD8+ T cells in the circulation of cancer patients[75] However, enhancement of hTERT -specific CD8+ T cells in the circulation, following vaccination in our study were substantially ... following cycles of vaccination (for patients L001–L006) Similarly, significant enhancement of hTERT -specific cytotoxicity was observed following courses of vaccination in L001–L006 Vaccination of...
- 23
- 439
- 0
Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt
... 5'-TGAACTGGACTTCTCCCATTTCCGTCTTTT-3' 5'-CCTGGTTTGTTAATTGGATTAACGA-3' 5'-GAGGTGGAGTGTTGCAAAGGTAGT-3' 5'-CCCATACCAACATCCCTGAGCTGTCAA-3' 5'-AGCTCTGCCTTCACTACAGAGACTT-3' 5'-GCTTTTATGGAAACCTTCATGGA-3' ... 5'-CCCGGTGTGGCCATTGCTGC-3' 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' ... (TP) TRAM (FP) TRAM (RP) TRAM (TP) Sequence 5'-CCCATTCCGCAGTACTCCATT-3' 5'-TTTCCTTGGGCCATTCCA-3' 5'-CAGTTATCACAAGCTCAAAAGTCTCATGGCCA-3' 5'-TGTGAAGAGTGAGTGGTGCAAGT-3' 5'-ATGGCAGCATCATTGTTCTCAT-3'...
- 15
- 374
- 0
Báo cáo y học: "Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls - data from the osteoarthritis initiative" pptx
... The Institutional Review Boards at all units participating in the Osteoarthritis Initiative, including the clinical centers and the OAI Coordinating Center at UCSF, have reviewed and approved the ... fibrillation and cartilage thinning [2, 3] Biochemical alterations to the articular cartilage often occur prior to morphologic degeneration [4], thus evaluating the biochemical composition of cartilage ... Osteoarthritis, T2 Osteoarthritis Initiative (OAI)} Abstract Introduction: The goals of this study were (i) to compare the prevalence of focal knee abnormalities, the mean cartilage T2 relaxation...
- 34
- 294
- 0
An analysis of key changes under ucp 600 compared to ucp 500 and recommendations for better ucp 600 application.doc
... rejection Seventy percent documentary discrepancy in letter of credit transaction is the statistic collected by ICC Thailand in 2002 This fact along with the increasing demand in international trade ... Restricted negotiable letter of credit When any specific bank is authorized to pay, negotiate or accept, the credit is called restricted or special credit 1.2.2 The mechanics of letter of credit ... proportion of documentary rejection under UCP 500 Seventy percent documentary discrepancy in letter of credit transaction is the statistic collected by ICC Thailand in 2002 This fact together with...
- 89
- 965
- 2
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... organic compounds.31) A systematic review of provocation studies concluded that individuals with MCS reacted to chemical challenges, suggesting that the mechanism of action is not speci c to the chemical ... another ailment, known as multichemical sensitivity (MCS), which is a chronic medical condition characterized by symptoms that the affected person attributes to exposure to low levels of chemicals ... es- Titanium Dioxide A study reported the potential of water photolysis using a titanium dioxide (TiO2 ) electrode by radiation with ultra-visible light.144) TiO2 -based photocatalytic compounds145–148)...
- 14
- 940
- 1
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... http://www.translational-medicine.com/content/6/1/51 Figure The ability of vaccination with autologous FCs to stimulate T cells The ability of vaccination with autologous FCs to stimulate T cells ... vaccination were investigated We first assessed the ability of autologous FCs vaccination to stimulate T cells After the ninth vaccination, unirradiated DCs/auto-HCC stimulated T- cell proliferation ... CTL by vaccination with autologous FCs We next examined whether fusion cell vaccination could augment the induction of HCC cells -specific CTL in the patient Before vaccination, coculture of nonadherent...
- 19
- 459
- 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
... killing activity These data showed CTLs to be highly AAV/IE1 specific and MHC class I restricted Figure demonstrates that the use of AAV/GFP/ Figure Cytotoxicity assay Cytotoxicity assay Killing was ... http://www.translational-medicine.com/content/6/1/56 AAV/IE1-transduced DCs stimulated AAV/IE1 -specific CTLs We analyzed the ability of the AAV/IE1 vectors to generate IE1 specific- CTLs (optimal ratio E :T; 1:20) To analyze CTL activity, ... target for CD4+ and CD8+ T cells [21] IE1 was the first gene product identified to elicit CTL responses in mice [22] The role of IE1-recognizing CD8+ T cells will be an interesting subject to study...
- 8
- 451
- 0
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf
... Quantitative detection of sjTRECs can be applied for direct measurement of thymic output and proliferative history of T cells [6] Over the last decade the technique was used to evaluate T- cell immune ... evaluation of the complexity of thymic output in different TRBV subfamily naïve T cells, which is an important factor in immune competence In this study, we analyzed the total 23 subfamilies of TRBV-DB1 ... Magnetic Cell sorting technique (Miltenyi Biotec, Bergisch Gladbach, Germany) After CD4+ and CD8+ T cells sorting, the purity was determined by indirect immune fluorescent analysis The positive cells...
- 8
- 367
- 0
Báo cáo hóa học: " The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture" pptx
... Federation to address the issue of utilizing bacteriophage for bacterial control Interestingly, electron micrographs of a bacteriophage that attaches to C jejuni, but productively infected Proteus ... characteristics [28,29] There consequently may be two interesting applications of this effect First, it may be possible to test phage PV22 as an antimicrobial agent to control C jejuni colonization ... titration of the PV22 with its host A preliminary chemotaxis assay was conducted as described by Adler [34] utilizing a capillary method with chicken epithelial cecal cells as the attractant...
- 5
- 260
- 0
Báo cáo khoa học nông nghiệp " Assessment of capacity improvement within IPSARD/CAP: Baseline survey of knowledge, skills and attitudes (KSA) compared to end-of-project survey of KSA " docx
... IPSARD/CAP which is exposed to multiple influences that can change capacity, it would be expected to be difficult to show changes specific to any one intervention This analysis has attempted to show ... distributors of livestock feed in Vietnam 13 Vietnamese SMEs operating in the livestock feed sector have the capacity to adapt to changing market conditions 14 The quality of processed livestock ... Principles of the economics of supply/value chains The role of SMEs in the livestock feed sector in Vietnam Indicators of the competitiveness of firms The theory of transactions costs Government policies...
- 17
- 284
- 0
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... and CD8+ T cells This accelerated differentiation may be due to a non-antigen -specific effect in RA that differentiates all peripheral T cells irrespective of their specificity, or it may actually ... types that can be recruited into the synovium, then a vicious cycle may be set up in RA in which there is continuous generation of CD8+ T cells that can be recruited into the synovium, resulting ... for HIV -specific CD8+ T cells, in which there is an accumulation of preterminally differentiated CD45RA–CD62L– CD8+ T cells [12,16], and such a lack of differentiation may result in functional...
- 6
- 323
- 0
Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps
... juvenile idiopathic TCCL21) chemokines (CXCL11 Chemotactic activity of CD4 memory arthritis from the synovial fluid of eight patients with juvenile idiopathic arthritis to inflammatory (CXCL11 and CCL3) ... RF negative polyarticular JIA, and with systemic JIA) were tested for CCL21 concentrations The clinical characteristics of patients with JIA and the ongoing treatment at the time of the study are ... which migrate to the peripheral tissues to perform their effector functions [6] taxis of the latter cells to the ligands of these receptors, and the distribution of cells positive for CCR7, CCR5...
- 12
- 359
- 0
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps
... CCATGAAGGTCTCCGCGGCAC, reverse CCTAGCTCATCTCCAAAGAG; CCL3, forward ATGCAGGTCTCCACTGCTGC, reverse TCAGGCACTCAGCTCCAGGTC; CXCL10, forward AAGGATGGACCACACAGAGG, reverse ACCCTTGGAAGATGGGAAAG Control primers ... synovial fluid T cells This showed a significant increase in the CCL5 positive cells within this CD8+ CD28+ population in the synovial T cells compared to PB (Figure 5c) In addition, these CD28+ CCL5+ ... Ferlito F, Favre A, Uccelli A, Gambini C, Martini A: Phenotypic and functional characterisation of CCR7+ and CCR7- CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis Arthritis...
- 11
- 508
- 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
... anti-tumor lymphocytes into the irradiated tumor during CRT, which may lead to improvement of the clinical efficacy of RT in rectal cancer Taken together, our results indicate that the quantitative ... be caused by destruction of the tumor microenvironment by CRT, which facilitates the recruitment of circulating T cells In fact, Lugade et al have suggested that radiation-induced IFNg production ... papilloma virus, specific viral proteins processed in tumor cells may critically affect the histological characteristics of the tumor stroma, which may account for the discrepancy between their study...
- 6
- 371
- 0
Báo cáo khoa học: " Does Intensity Modulated Radiation Therapy (IMRT) prevent additional toxicity of treating the pelvic lymph nodes compared to treatment of the prostate only?" ppt
... proved the advantage of IMRT compared to 3D-CRT in treatment of PO as well as treatment of the WP, it is not possible to estimate the additional risk of IMRT treatment of the pelvic lymphatics compared ... to the rectum for IMRT compared with 3D-CRT in treatment of PO [6-8] Early clinical results confirmed the potential of IMRT with low rates of toxicity despite escalated treatment doses to the ... relationship for rectal toxicity in treatment of the prostate cancer All studies concluded that the high and mid dose region is most predictive for rectal toxicity [24-31], whereas no correlation...
- 12
- 386
- 0
Báo cáo y học: "Skewed distribution of proinflammatory CD4+CD28null T cells in rheumatoid arthritis" docx
... joint is restricted to certain TCR-Vβ subsets, and that RA patients can be divided into two distinct groups with regard to different access of CD4+CD28null T- cell subsets to the joint Associations ... for anti-citrullinated peptide/protein antibodies, and (c) , (d) patients with or without erosive disease bution of virus -specific T cells in a site other than the actual site of virus infection ... equal distribution in patients with and patients without erosive disease, indicates no significant role for CD4+CD28null T cells in the local inflammation driving joint destruction Instead, these...
- 11
- 404
- 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... CII -specific T cells DCs from the tolerized mice inhibited the proliferation of CII -specific T cells and inflammatory cytokine production compared with DCs from CIA mice, and these suppressive ... induction of IDO enzymatic activity by DCs, our data support IDO-dependent mechanisms that have been associated with induction of T- cell tolerance and immune inhibition in the induction of oral tolerance ... flow cytometry to investigate the possible conversion of CD4+CD25- T cells into CD4+CD25+ T cells in concomitance with Foxp3 appearance CD4+CD25+ T cells obtained by coculture with CD1 1c+ DCs from...
- 10
- 473
- 0
Báo cáo y học: " Heterogeneity of human effector CD4+ T cells" doc
... sufficient to induce IL-4 production IL-2-mediated activation of STAT-5 plays a critical role in inducing/maintaining accessibility at the second intron HSII and HSIII DNase I hypersensitive sites of the ... development of insulin-dependent diabetes mellitus was prevented by the treatment with anti-IFN specific antibody but not with anti-IL17A -specific antibody [80] The plasticity of Th17 cells into Th1 cells ... role of TGFβ in the differentiation of human Th17 cells is controversial, with some studies indicating that the addition in the culture of exogenous TGFβ is critical for the induction of RORC expression...
- 8
- 259
- 0
Báo cáo y học: "Defining the chromatin signature of inducible genes in T cells" pps
... genomic regions through their interaction with transcription factors that recognize their cognate DNA binding sites (reviewed in [1]) The components of the Pol II initiation com- Volume 10, Issue ... activities, most likely brought about by the induction of inducible transcription factors that more efficiently recruit and activate Pol II Many inducible genes in T cells are controlled by inducible ... correlation, complete linkage clustering and viewed with TreeView (Stanford) Abbreviations ChIP: chromatin immunoprecipitation; ChIP-on-chip: ChIP combined with microarray technology; ChIP-qPCR: ChIP...
- 18
- 641
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25