poly a metabolism methods to determine positions abundance and lengths of short oligo a tails
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 ... 5¢-GGGAATTCCATATGGCTAAGGGGCAA TC and 5¢-AGGATCGCTGGATCCCCGTGTAAAAAA AC, respectively, with pTX367 plasmid [8], creating an NdeI site that included the translation initiation codon and a BamHI...
- 10
- 488
- 0
Báo cáo lâm nghiệp: " Comparison of three methods to determine optimal road spacing for forwarder-type logging operations" pdf
... assuming the load volume and slope at their average The total cost was calculated by adding up roading and travelling costs The total cost was plotted as a function of road spacing (Fig 2) RESULTS ... time and constant hourly machine cost regardless of the load or speed Then the sum of roading cost and forwarding cost was plotted as a function of road spacing The sum of roading cost and travelling ... calculation using observations from a forwarding study in Austria Speed as a function of distance is examined The optimal road spacing is also calculated using Matthews’ and Sundberg’s methods to...
- 9
- 348
- 0
comparing different methods to determine digestibility of snakehead (channa striata) juvenile
... Hussain, M Afzal, M Salim, A Javid, T A A Khichi, M Hussain and S A Raza 2011.Apparent digestibility of fish meal, blood meal and meat meal on Labeo rohita fingerlings The journal of animal and plant ... Some sneakhead species lived in Mekong Delta: - Snakehead murrel (Channa striata) - Dwarf snakehead (Channa gachua) - Giant sneakhead (Channa micropeltes) - Splendid snakehead (Channa lucius ... tank would lead to metal layer to separate feces and water The feces were hold on metal tray The settling tank is commercial tans Aqua Optima with 170ml of volume and 44cm of height with diameter...
- 39
- 137
- 0
Tài liệu Capitalize this- a guide to the proper care and feeding of capital letters doc
... names of family relations when they are used as substitutes for names: I went to visit my Uncle Ted and Aunt Margaret Grandma and Grandpa live with Dad and Mom now I went with my mom and dad to visit ... geologists call this material “garbage”) is often deposited in formations called morains Capitalize the personal pronoun I A CAPITAL IDEA! The Uses and Rules of Capital Letters Capitalize the names of ... after a name Joe Chuckles, who was chairman of the board of directors in 1995, has since retired A CAPITAL IDEA! The Uses and Rules of Capital Letters You can capitalize the names of political...
- 13
- 658
- 1
Tài liệu THE ENCYCLOPEDIA OF HOLLYWOOD: AN A TO Z GUIDE TO THE STARS, STORIES, AND SECRETS OF HOLLYWOOD docx
... stars For the most part, animals have traditionally played supporting roles to human actors, but a number of assorted animals have managed to ascend to a star status of their own Animals, of ... filmmaker At a Labor Day party, a young woman named Virginia Rappe took ill and died Arbuckle was accused of rape and manslaughter The scandal rocked Hollywood and destroyed Arbuckle’s career, despite ... Domínguez Banderas) (1960– ) The popular and hardworking star was born in Malaga, Spain, and had soccer aspirations until he broke a foot at the age of 14 and turned his attention to theater After taking...
- 561
- 659
- 0
NEED AND METHODS TO IMPROVE THE QUALITY AND REDUCE RICE LOSSES DURING RICE PRODUCTION IN MEKONG RIVER DELTA pptx
... Delta of Vietnam” is a part of Collaboration for Agriculture and Rural Development Program (CARD) between Vietnam Ministry of Agriculture and Rural Development (MARD) and Australian Agency of ... Tran Minh Tuan The fact and solutions of mechanization of harvest and post-harvest methods in MRD MPhil Tong Huu Thuan PART Presentation of techniques: harvesters, driers, and millers Harvesters ... The Tien Giang extension center reported a 4.5% of losses due to harvesting They said that harvesting in Tien Giang was always late due to the lack of labors and harvesters The mechanical drying...
- 9
- 274
- 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx
... psychosocial, psychological and pharmacological treatment, and to determine facilitators and obstacles Secondary outcomes (percentage accuracy of depressiondetection in usual care, prevalence of depression-diagnosis ... self-care, usual activities, pain/discomfort and anxiety/depression) and a rating of ‘own general health’ by means of a visual analogue ‘thermometer’ scale The EQ5D has shown a good validity and ... care program Act In case of Depression (AID), a multidisciplinary care program to identify and treat depression and monitor treatment effects The care program is based on and in accordance with...
- 7
- 484
- 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf
... no professional input They can be used as stand-alone interventions or as an adjunct to other forms of intervention This is a rapidly growing area and a recent meta-analysis of studies evaluating ... before a large scale clinical and cost effectiveness evaluation of this approach Specifically, the trial will provide extensive quantitative and qualitative data on the acceptability of the intervention ... instrumental in the recruitment and assessment of all participants including strategy development All authors have contributed to the writing of this paper and have read and approved the final paper...
- 7
- 305
- 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
... the program proves effective and acceptable to participants, we aim to develop a treatment manual to support future programs The hypotheses are that when compared to treatment as usual (TAU) the ... below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence measures were created specifically ... negotiate when and how to allocate their hours per fortnight and it is anticipated that while most time will be spent face -to- face, a small proportion will also be allocated to phone and email...
- 7
- 443
- 0
Báo cáo y học: "andidemia on presentation to the hospital: development and validation of a risk score" pptx
... be generalizable to a broad range of patients presenting to acute-care hospitals because they are derived from teaching and non-teaching hospitals and from urban and rural hospitals, and are not ... cohort (Table 2) [see Additional data file 2] Derivation and validation of candidemia risk score Univariate analysis revealed that the following variables were associated with candidemia: age younger ... presentation on admission as candidate variables, which is likely to be a strength of our paper because many large-scale databases tend to only have the results of administrative coding and lack actual culture...
- 10
- 394
- 0
Báo cáo y học: "Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails" ppsx
... 5'CCAAGTGTATGCCATTGAGCAA-3' for snt-1; acr5-52: 5'AATCGATTTATGGACAGAATTTGGA-3' and acr5-32: 5'ATGTTGCAAAAGAAGTGGGTCTAGA-3' for acr-5; odr10-51: 5'-TCATTGTGTTTTGCTCATTTCTGTAC-3' and odr10-31: 5'ATATTGTTCTTCGGAAATCACGAAT-3' ... 5'-GATCTCGCAGAAAAGTTCTGCAA-3' for unc-8; unc54-52: 5'-AACAGAAGTTGAAGACCCAGAAGAA-3', and unc54-32: 5'-TGGTGGGTGAGTTGCTTGTACT-3' for unc-54; snt1-51: 5'-GAGCTGAGGCATTGGATGGA-3' and snt1-31: 5'CCAAGTGTATGCCATTGAGCAA-3' ... 5'-CCGGTACGACGGTCAACCT-3' for eft-3; tax2-54: 5'-GATTAATCCAAGACAAGTTCCTAAATTGAT-3' and tax2-34: 5'TTCAATTCTTGAACTCCTTTGTTTTC-3' for tax-2; unc8-52: 5'-TCTCAGATTTTGGAGGTAATATTGGA-3', and unc8-32:...
- 13
- 301
- 0
A research to assess community ecotourism and suggestions of solutions for sustainable tourism development in Van Don District, Quang Ninh province
... has a total area of 2,171.33 km2, of which the natural land area of 551.33 km2, 1620 km2 of the open sea Island District includes 11 communes and one town of Cai Rong The district has a total ... have created for natural ecological landscapes of Van Don particularly attractive characteristics 2.2.2 Climate potential The climate of Van Don has features of a tropical climate with two seasons: ... conical Karst towers are common in Bai Tu Long bay, developing limestone island landscape, and it is a region having international significance on Karst landscape, as the basis of geomorphological...
- 19
- 646
- 1
Roles of siRNAs and miRNAs in host responses to virus infection identification and characterization of a novel viral suppressor of RNA silencing
... plants Is RNAi also antiviral in animals? Flock house virus (FHV), which can infect both animals and plants, was demonstrated as both an initiator and a target of RNA silencing in Drosophila ... (Catalanotto et al., 2000), RDE1 from C elegans (Tabara et al., 1999), AGO1, AGO2 from Drosophila (Williams and Rubin 2002; Carmell et al., 2002) and AGO1, AGO4 from Arabidopsis (Fagard et al., ... a separate role that is associated with the systemic signaling of RNA silencing and RNA-directed DNA methylation in the nucleus Animals may also have a system for amplification and spread of silencing...
- 195
- 312
- 0
Introduction to the basic approaches and issues of Intrusion Detection
... President’s approval; * *President can raise any or all sectors President can raise any or all sectors to Orange at any time ififaa“national to Orange at any time “national emergency” is declared emergency” ... capabilities are staffed and operable Insure disaster recovery capabilities are staffed and operable State/Federal Assistance: State/Federal Assistance: * *Full mobilization of National Guard and Reserve ... criticality of the target and lethality of the attack, and the effectiveness of system and network countermeasures • Impact is calculated by the analyst • Delays in detection and reaction can increase...
- 34
- 445
- 0
Tài liệu Global action plan to control the spread and impact of antimicrobial resistance in Neisseria gonorrho pdf
... Ministry of Health and Child Welfare, Harare, Zimbabwe Farinaz Rashed Marandi, Department of Bacteriology, Research Center of Reference Laboratory of Iran, Tehran, Islamic Republic of Iran Margaret ... publication and dissemination of a national mitigation plan Establishment and strengthening of monitoring and evaluation mechanisms based on a clear plan of what is to be achieved, how and by ... follow-up and treatment of sexual partners will need careful planning and additional human and financial resources Appropriate treatment options need to be made available to persons who are allergic to...
- 40
- 511
- 1
Báo cáo khoa học: From meiosis to postmeiotic events: Alignment and recognition of homologous chromosomes in meiosis ppt
... aggregated, and those DNA regions that are not undergoing transcription protrude from the factory and form a chromatin cloud; therefore, a chromosome appears as a linear array of many factories and clouds ... chromosomal motion probably has dual roles: first, to act as an attractive force by agitating chromosomes to increase their chance of contact with a homologous partner, and second to act as a repulsive ... nematode C elegans In this organism, special nontelomeric regions on chromosomes play a role analogous to telomeres in bouquet arrangement, and act as a pairing center that promotes pairing and...
- 6
- 473
- 0
guide to the design, selection, and application of screw feeders
... understanding grew of their advantages and limitations, the ingenuity of engineers produced a plethora of applications in all industries, from food and pharmaceuticals to waste and sewage handling ... repetitive handling duties, as with grain and flour handling The urge to save manual labour and deal with higher quantities of material prompted wider uses and many misapplications However, as an understanding ... processes and plant performance The Rand report indicated that, in general, plants handling loose solids have a far inferior performance to those that handle liquids and gases It went on to say that,...
- 178
- 524
- 0
motley - darwin's harvest - new approaches to the origins, evolution and conservation of crops (columbia, 2006)
... tepary beans (Phaseolus acutifolius A Gray) and wild rice (Zizania aquatica) appear to be of North American origin Maize, papaya, cassava, cacao, avocado, beans (Phaseolus spp.), chayote, squash, ... (Panicum miliaceum), and foxtail millet (Setaria italica) are from China The tropical areas of Southeast Asia and the Pacific are the source areas for rice (Oryza sativa), taro, sugarcane, breadfruit, ... indebted to Gavrilova Vera, Boris Makarov, and Tamara Smekalova at the vir, who opened up their facilities (research laboratories, herbarium, and seed storage units) and gave freely of their time and...
- 401
- 379
- 0
semantic web and peer-to-peer decentralized management and exchange of knowledge and information
... direct subclass of a class B if A and B are not equal and there is no class C that is a subclass of B and a superclass of A It is important to note that these built-ins are not merely syntax shortcuts, ... [7] and Sesame [6] It offers many attractive qualities such as an easy to use syntax format The main advantage of RDQL is that it is simple, allowing easy implementation across platforms and ... Buneman, and Dan Suciu Data on the Web: From Relations to Semistructural Data and XML Morgan Kaufman, 1999 [2] So a Alexaki, Vassilis Christophides, Greg Karvounarakis, Dimitris Plexousakis, and...
- 359
- 349
- 0
Báo cáo nghiên cứu nông nghiệp " Increasing the capacity of the Food Crops Research Institute to enhance the Production and Management of Potatoes in the Red River Delta " pot
... domestic and export markets and the various means farmers have of collectively manipulating the supply of potatoes (and prices) to the market The hands-on nature of most the research and development ... technology of seed and ware potatoes 2.2.3.3 To identify possible research projects on alternative methods of extending the shelf life of seed and ware potatoes in storage 2.2.4 To demonstrate to potato ... Joanna Embry and Ashe Briscoe The presence of two AYAs in Hai Duong ensured that project activities were regularly monitored and evaluated, with reports being made to the WADA project manager and...
- 12
- 508
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25