... hazardous materials/chemicals maintained? Are discrepancies in daily inventory of hazardous materials/chemicals immediately investigated? Are the storage areas for hazardous materials/chemicals ... occurring again Date Area Tested Results Signature Corrective Action Taken Date Action Taken Signature Food Defense Plan Assessment and Revision Review your plan and revise it, as needed, at least annually ... tanker trucks and/ or rail cars? Are chain-of-custody records maintained for tanker trucks and/ or rail cars? Developing a Food Defense Plan for Meat and Poultry Slaughter and Processing Plants 15 Which...
... Environmental taxes Communications and air transportation taxes Fuel taxes Tax on the first retail sale of heavy trucks, trailers, and tractors • Manufacturers taxes on the sale or use of a variety ... your car loan, and certain state and local taxes ! Choosing the standard mileage rate If you want to use the standard mileage rate for a car you own, you must choose to use it in the first year ... Tax (AMT) Assistant available online at www.irs.gov/individuals • Sign up to receive local and national tax news by email • Get information on starting and operating a small business Phone Many...
... philanthropic and social-liberal ideas envisaged savings banks as a means to fight and prevent poverty In Hamburg a savings bank was founded in 1778, “for people of lesser means”, anda few years ... great importance Because of the saving bank’s philanthropic and patriarchal nature, and because its loans were small, borrowers and guarantors were trusted more than real securities In small ... 36 In many cases, loans were granted to the members of savings bank boards of directors, but also against personal guarantee and against collateral In ports, loans were usually granted against...
... Sigma prepared reagent and BSA as the standard Synthesis and spectroscopic characterization of phytoalexins and analogue library Compounds and phytoalexins shown in Tables and supplementary Table ... 137 89 QSSASTMR KALAAFAADRA RLAAAFAVSRM RAVFPSIVGRS AYPGYAPFR RGYSFTTTAERE RNTLLIAGLQARN MLLLSQPGRAR TLYGGMLDDDGR KDQLLLGPTYATPKV RLEGLTDEINFLRQ LAAPVAVVTGASRGIGR KHSGPNSADSANDGFVRL RGMGGAFVLVLYDEIKKF ... KNASCTLSSAVHSQCVTRL VVSESNQATNLLTAEMKA KVSGAAAQQAVSYPDNLTYRD GYYAMDYWGQGTSVTVSSAK RDAAVSPDLGAGGDAPAPAPAPAHTRD DVLMTRTPLSLPVSLGDQASISCRS Table Effect of electron acceptors on BO activity BO activities...
... problems in Banach spacesm J Inequal Appl 2010, 2010:14, (Article ID 869684) 12 Cioranescu I: Geometry of Banach spaces, Duality Mappings and Nonlinear Problems In Mathematics and Its Applications ... Appl 2008, 2008:11, (Article ID 528476) Takahashi W, Zembayashi K: Strongand weak convergence theorems for equilibrium problems and relatively nonexpansive mappings in Banach spaces Nonlinear ... spaces are reflexive Now let E be a smooth and strictly convex reflexive Banach space As Alber [13] and Kamimura and Takahashi [14] did, the Lyapunov functional j : E × E ® ℝ+ is defined by φ(x,...
... mixed stands of Q petraea and Q robur The sampled stand covers approximately with a total of 286 standing trees It consists of three ecological zones: a small valley, a plateau anda regular intermediate ... Le Mans, Orléans and Fontainebleau which organized the lumberyard and gave the logs They have provided precious raw material and an unrivalled collection for research We thank also JeanClaude ... investigate relations between variables, Spearman rank-order correlation coefficients, which are based on the ranks of the data rather than on the actual values, were used 2.3.3 Spatial analysis We have...
... postoperatively, the grafted cartilage was not as intact as normal cartilage, and that the grafted cartilage was thicker than the normal articular cartilage Also, the histological appearance of ... human clinical and animal studies it has been shown that osteochondral plugs maintain hyaline cartilage coverage over the subchondral bone, and that the plugs retain their viability and attach ... 10:535-541 Laasanen MS, Toyras J, Vasara AI, Hyttinen MM, Saarakkala S, Hirvonen J, Jurvelin JS, Kiviranta I: Mechano-acoustic diagnosis of cartilage degeneration and repair J Bone Joint Surg Am 2003,...
... ERS1 (Fig 1A) Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), with capitals indicating ERS1 sequence and parentheses indicating T-DNA left border ... the 3' end of an ERS1 cDNA clone (5'-ACTAGTGACTGTCACTGAGAA-3') or an ETR1 cDNA clone (5'-ATCCAAATGTTACCCTCCATCAGATTCAC-3') Radio-labeled probes were made and stripped between hybridizations by using ... T-DNA insertion, and ETR1-3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5' CAAGCATCCATAACTCGATCCAAATTC 3') for amplification of a product 3' to the site of the T-DNA insertion After 25 cycles,...
... urban infrastructure and flood control projects He is also preparing a publication on climate risk management and adaptation Liana Zanarisoa Razafindrazay is a Consultant on the East Asia and ... operations and analytical products supporting the improvement of weather, climate, and hydrological services, initially in Europe and Central Asia and later in East Asia, Africa, South Asia, and ... ARPDM ASEAN Regional Programme on Disaster Management ASEAN Association of Southeast Asian Nations AusAID Australian Agency for International Development BNPB Indonesian National Disaster Management...
... field has one main maximum and several neighboring secondary maxima The further away from the main maximum, the secondary one is the smaller But in the case of absence of an external magnetic ... low-dimensional systems are obtained The analytical expressions are numerically calculated and discussed to show the differences in comparison with the case of absence of an external magnetic with a specific ... this article, we assume that the quantization direction is in z direction and only consider intersubband transitions (n = n ) and intrasubband transitions (n=n’) We consider a compositional superlattice...
... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA scoreand circulating Ang-2 (Table ... circulating Ang-1 and Ang-2 Ang-1 and Ang-2 were measured by in-house Immuno Radiometric Sandwich Assay (IRMA) and ELISA, respectively as previously described [27,34] Polyclonal, anti-human Ang-1 affinity ... et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and VEGF concentrations and...
... ICU admitting diagnosis, Acute Physiology and Chronic Health Evaluation (APACHE II) score [13], Sequential Organ Failure Assessment (SOFA) score [14] and Glasgow coma score The Glasgow coma score ... interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript All authors read and ... assumed a 25% mortality rate in the control group Statistical analysis Data is presented in absolute numbers and proportions for nominal variables Mean ± standard deviation (SD) or median and interquartile...
... intramedullary cysticercosis and whose clinical courses are stable The potential advantages of medical therapy alone include avoidance of surgery and treatment of surgically unreachable and multifocal ... from a week to 10 years20 The common clinical manifestations included pain, paraparesis, spasticity, bowel and bladder incontinence, and sexual dysfunction1,20 However, inflammatory reaction against ... Kumar S, Handa A, Chavda S, et al Intramedullary cysticercosis J Clin Neurosci 2010;17(4):522-3 14 Lmejjati M, Aniba K, Haddi M, et al Spinal Intramedullary arachnoid cyst in children Pediatr...
... Ramsey NF, Mandl RC, et al Language lateralization in monozygotic twin pairs concordant and discordant for handedness Brain 2002; 125: 2710-8 Vernooij MW, Ikram MA, Tanghe HL, et al Incidental ... 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research ... MZ with discordant handedness showed opposite brain activity patterns in language anda mental rotation task Sommer et al 14 have suggested that late splitting of the egg may play a role in twins...
... reported satisfaction Authors Ed Michaels, Helen Handfield-Jones, and Beth Axelrod make a case from these and other findings that companies can attract and retain talented people if they pay attention ... autonomy as they can handle Many people enjoy working with a minimum of supervision So, give people as long a leash as they can handle Doing so will make them happy and make your job as manager easier ... customers: a measure of perceived value for a particular cost.They suggest that if companies want to be more successful at attracting and retaining talent, they should evaluate and strengthen their value...
... trying to acquire and retain Herb and the segment he represents is generally wasted We used a credit card company as an example but could as easily have used another: a retail stock brokerage, a subscription ... income and modest net worth He uses his card for online purchases, shopping, and restaurant meals.Whenever he accumulates an account balance that he cannot pay off in a few months, Herb transfers ... particular, an aging work force anda growing imbalance in the supply and demand of qualified personnel In addition, today’s workers have different expectations about work-life balance • People stay with...
... elements that create satisfaction and dissatisfaction within a particular job, you may be able to split off the dissatisfying tasks entirely and give them to other individuals who will appreciate the ... looking for in another operating unit or department So make sure that internal postings are available and easy to access One way to this is with an online internal job search tool Here are a few tips ... education, and native talent you presume a successful candidate must have.You may discover that someone with less of the above anda person with less employment mobility—can a credible job.This advice...
... returns a DataSet with a DataTable containing the one row from the Customers table with a CustomerID of ALFKI, as shown in Figure 17.5 Notice that the equals (=) and single quote (') characters ... with a DataTable containing all the rows from the Customers table (see Figure 17.6) Notice that the space characters in the whereClause parameter value have been converted to plus (+) characters ... name="RetrieveCustomersSoapIn"> ...
... the other hand, the same investments that make people more valuable make them more marketable and attractive to personnel poachers Many of America’s major brokerage firms, for example, have long ... standards, and employees maintain their “employability” and, in some cases, advance to higher levels Informal and Formal Approaches Skill training is either informal or formal Informal training ... described by Clair Brown and Michael Reich: In Japan, OJT is as carefully planned, mapped, and recorded as company-provided classroom training.Training and skill development are an expected part of every...