placenta fetus a slippery slope between defence and transmission
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... (2001) The Rad51 and Dmc1 recombinases: a non-identical twin relationship Trends Biochem Sci 26, 131–136 Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A, Chiku H, Kamada T & Sakaguchi K ... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG...
- 10
- 487
- 0
Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
... just 30% of the target data to the source data achieved the same performance as that obtained by taking the entire source and target data Agirre and de Lacalle (2009) reported a 22% error reduction ... Comparing random strategy with oracle based ideal strategy for SemCor to Health adaptation Figure 6: Comparing random strategy with oracle based ideal strategy for SemCor to Tourism adaptation ... Research in Computational Linguistics, pages 19–33 Mitesh Khapra, Sapan Shah, Piyush Kedia, and Pushpak Bhattacharyya 2010 Domain-specific word sense disambiguation combining corpus based and...
- 10
- 337
- 1
Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf
... from Mandarin than other regions in Mainland China One can easily spot Cantonese dialect articles in Hong Kong newspapers which are totally unintelligible to Mandarin speakers, while Mandarin articles ... J., Tomita M and Goodman K (1992) Machine Translation: A Knowledge-Based Approach Morgan Kaufmann Publishers, San Mateo, California, USA Sinclair J (1991) Corpus, Concordance and Collocation Collins, ... Design and Implementation A rudimentary design of a Cantonese-Mandarin dialect MT system has been made, as shown in Figure The system takes Cantonese Pinyin sentences as input and generates Mandarin...
- 5
- 438
- 0
taking shape - a new contract between architecture and nature
... humankind’s expulsion from the Garden Woman was blamed for the Fall, the fall of nature as much as of ‘man’, as what was once gentle and immortal became hostile and ultimately fatal We die, and ... (Plate 6): In the garden we are in the space of nature and culture, form and matter, concrete and abstract, exterior and interior And, significantly, we are in a space of the feminine and the masculine ... to Hyde Park as nature We say certain acts are not ‘natural’, and speak authoritatively about what ‘nature intended’ Ecologists describe an empirically measured nature, and poets and explorers...
- 236
- 485
- 0
Báo cáo y học: "a diagnostic dilemma between psychosis and post-traumatic stress disorder: a case report and review of the literature" ppsx
... reactive She described vivid and clear auditory and visual hallucinations and persecutory delusions Her medical psychiatric, personal, and family histories were unremarkable A physical examination, ... images of the traumatic event, with a markedly diminished interest and participation in significant activities and the avoidance of thoughts and conversations associated with the trauma She also ... Statistical Manual of Mental Disorders edition Washington, DC: APA; 1994 Kilcommons AM, Morrison AP: Relationships between trauma and psychosis: an exploration of cognitive and dissociative factors Acta...
- 5
- 407
- 0
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot
... 5'-TGTTTGGAGACTGTGTACAAGGCG-3', hTERT sense, 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GATGAAGCATTCCAACCACGG-3' ... TRF1 sense,5'-GCTGTTTGTATGGAAAATGGC-3' and antisense: 5'CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCTTCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAGGATTCCGTAGCTG-3' The thermal cycling conditions ... progression of adult T-cell leukemia Leuk Res 1999, 23:311-316 Kubuki Y, Suzuki M, Sasaki H, Toyama T, Yamashita K, Maeda K, Ido A, Matsuoka H, Okayama A, Nakanishi T, et al.: Telomerase activity and telomere...
- 10
- 281
- 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf
... virus replication At regular intervals, cells and filtered supernatant were stored at -80°C and virus was quantitated by CA-p24 ELISA When a revertant virus was identified, DNA was extracted from ... study JPM participated in the study design and coordination BB supervised the study, and participated in its design and coordination All authors read and approved the final manuscript Acknowledgments ... the text) was passaged onto × 106 fresh MT-2 T cells in the presence or absence of 0.3 mM BME and virus spread was measured for 10 days the rate of appearance of syncytia and CA-p24 antigen production...
- 11
- 393
- 0
Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"
... conditions, ATP demands are immediately increased Carbohydrate fuel, as an anaerobic substrate, has the advantage of having a fast degradation rate and can occur in the absence of oxygen for rapid ATP ... on an ELISA analyzer (Tecan Genios, Salzburg, Austria) with the use of commercially available ELISA kits (Diagnostic Systems Laboratories, Inc Webster, Texas, USA), according to the manufacture’s ... according to the manufacturer’s procedures BP, HR, and arterial oxygen saturation BP and HR were measured quietly and at constant temperature (~ 23°C) Participants were provided with an automated oscillometric...
- 7
- 338
- 0
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
... from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns in gait and posture data may serve as an indicator ... Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13] This method recorded COP data and ... Hausdorff JM, and Goldberger AL Fractal mechanisms in neural control: Human heartbeat and gait dynamics in health and disease In: Walleczek J, Editor Nonlinear Dynamics, Self-Organization, and Biomedicine...
- 10
- 457
- 0
A comparative study of criticism between american and vietnamese online newspapers
... discrimination via the picture of their new president Barack Obama and the confirmation that “we’ve moved beyond race” Also, graphs and maps are used to clarify data presented in a critical story and ... 4.1.1 Chapter 4: RESEARCH AND DATA ANALYSIS Methodology Research questions This research aims at answering the following questions: - What are the ways that American and Vietnamese online newspapers ... many sources to appear together in the same virtual “space” That means all the journalism and media criticism that print makes possible is now available to anyone who can access a computer, vastly...
- 37
- 756
- 6
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
... singular form (of a noun of a particular class), and ‘teachers’ is plural form (of a noun of a particular class); and the difference between singular forms and plural form is semantically relevant: ... contrastive, not comparative) two values typologies (a CA is always concerned with a pair of languages), and founded on the assumption that languages can be compared.” CA describes similarities and ... • What are the grammatical and semantic features of each verb and how are they similar and different in terms of these features? • What are their synonyms and idioms? • What are the implications...
- 52
- 1,860
- 25
A contrastive analysis of passive voice between english and vietnamese
... thesis 1.3 Active voice and passive voice syntactically, semantically and pragmatically viewed Two popular categories of voice are often known as the active and passive voice In general, voice ... mainly based on the features of syntactic - semantic) and modern view (functional grammar with the pragmatic features) Both traditional and modern researches agree at one obvious feature that ... corresponding passive sentences are given as follows a Cô giáo/ r a tay/ cho/ The teacher/ wash hand/ adjunct/ him a Nó/ đợc/ cô giáo/ r a tay cho He /functional word/ teacher/ wash/ hand/ adjunct a Tay...
- 69
- 4,036
- 14
Tài liệu Navigating Between Parent and Child Records Using a DataRelation pptx
... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... // DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... can have multiple parents This method returns an array of DataRow objects Few commercial database products support manyto-many relationships between parent and child records Many-to-many relationships...
- 3
- 343
- 0
Ways of greeting and a comparison between vietnamese and english greetings
... Whereas in many countries and in the European continent, handshaking is done when meeting and departing day in and day out and even the same assortment of acquaintances, in England as well as Great ... than men are In Afghanistan, for example, men and women have their own ways of greeting strangers A man will greet by saying manda na bashi (may you not be tired) And a women will raise her hand ... introduced to a man who is at your age, what would you say and do? a How you do? b Please to meet you. and lightly embrace him c Please to meet you. And shake his hand d Say nothing and shake hand When...
- 37
- 14,228
- 67
Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt
... Similarly, separation appears to have occurred approximately 19 million years ago between E affinis and E americana (node A) and approximately 23 million years ago between E americana and E herdmani These ... GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 1994) were used to obtain sequences from COI Primer pairs 16SA2 (5Ј CCGGGT C/T TCGCTAAGGTAG) and 16SB2 (5Ј CAACATCGAGGTCGCAGTAA) were designed specifically ... BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; (31) Caspian Sea; (32) Gulf of Bothnia; (33) Gulf of Finland; (34) Sallvik...
- 14
- 491
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...
- 9
- 796
- 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... by averaging of 256 scans at a resolution of cm)1 The spectra were baseline corrected and normalized for equal area between 1711 and 1485 cm)1 Spectra were encoded every cm)1 Data analysis All ... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers...
- 6
- 555
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25