place all security sensitive code in a single jar and sign and seal it
the cert oracle secaure coding standard for java
... publisher was aware of a trademark claim, the designations have been printed with initial capital letters or in all capitals CMM, CMMI, Capability Maturity Model, Capability Maturity Modeling, Carnegie ... interest include safety, portability, reliability, availability, maintainability, readability, and performance Many of these attributes are interrelated in interesting ways For example, readability ... those designations appear in this book, and the publisher was aware of a trademark claim, the designations have been printed with initial capital letters or in all capitals The authors and publisher...
- 738
- 1,213
- 0
Tài liệu Debugging C and C++ code in a Unix environment ppt
... source in TeXinfo format, and is usually installed in ‘info’ format The GNU make manual This comes with the GNU make source in TeXinfo format, and is usually installed in ‘info’ format Paul Haldane ... through) A similar technique to ANWB debugging is to print your code, leave your terminal, and go to the cafetaria and some serious caffeine and sugar intake while reading (and annotating) your code ... and C++ code System call tracers A system call tracer is a program that allows you to see what system calls (including parameters and return values) a process makes It allows you to examine problems...
- 29
- 466
- 1
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx
... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...
- 8
- 410
- 0
Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx
... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...
- 8
- 446
- 0
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation Computers and Applied Mathematics, ... T M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 13 Z Daroczy and Z Pales, Eds., Functional Equations—Results ... dariu and V Radu, “Fixed points and the stability of quadratic functional equations,” Analele a Universit˘ tii de Vest din Timisoara, vol 41, no 1, pp 25–48, 2003 a ¸ 20 L C˘ dariu and V Radu,...
- 15
- 362
- 0
báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt
... doi:10.1186/1752-1947-5-462 Cite this article as: Mesmoudi et al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown ... reported a case of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... with modifications and revision of the manuscript MG helped with the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript...
- 4
- 310
- 0
Báo cáo y học: "Mortality associated with HIV-1, HIV-2, and HTLV-I single and dual infections in a middle-aged and older population in Guinea-Bissau" potx
... no increased mortality for HTLV-I However, mortality was associated with increased HTLV-I proviral load [19] Theoretically contracting HIV during Table 5: Mortality rates and mortality rate ratios ... study Cancer Causes Control 2003, 14:889-896 Iwata K, Ito S, Saito H, Ito M, Nagatomo M, Yamasaki T, Yoshida S, Suto H, Tajima K: Mortality among inhabitants of an HTLV-I endemic area in Japan Jpn ... Mayaud P, Mosha F, ka-Gina G, Klokke A, Gabone R, Gavyole A, Mabey D, Hayes R: HIV-associated adult mortality in a rural Tanzanian population AIDS 1997, 11:801-807 Nunn AJ, Mulder DW, Kamali A, ...
- 9
- 336
- 0
Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
... (leading to inadequate tissue perfusion), poor airway management, and inappropriate or inadequate anti-microbial coverage lead to increased morbidity and mortality in our patients Advances and improvements ... TBSA burn Inhalation injury was present in 20% of all admitted burns Figure Brain deaths Brain injury accounted for 16% of all deaths Anoxic brain injury accounted for 48% of the brain deaths after ... pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack that was the fatal event Respiratory...
- 7
- 265
- 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
... data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript ... [1-4] A randomised trial of 1548 patients hospitalised in a surgical intensive care unit (ICU) showed that maintaining normal glucose levels reduces morbidity and mortality [5] In another randomised ... manuscript All authors read and approved the final manuscript Available online http://ccforum.com/content/12/5/R120 Additional files The following Additional files are available online: Additional file...
- 9
- 635
- 0
Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt
... resting and inactive, and can only be activated by agonists Reports constantly support the constitutive activity of GPCRs, indicating that GPCRs have some basal activity in the cell even in the absence ... with G proteins increased GTPcS binding The cannabinoid receptor agonist WIN 55,212–2 (A) further increased GTPcS binding This binding was inhibited by the cannabinoid selective antagonist AM251 ... 14171 6A were used in the saturation binding assay Triplicates of positive reactions (radioactive ligand only) and duplicates of negative reactions (radioactive ligand + 10 lm cold ligand AM251)...
- 10
- 313
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... crosslink in determining the Soret spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was conserved Significantly, ... from N europaea in P aeruginosa was a cytochrome with catalytic and ligand-binding capabilities and UV-visible spectroscopic properties identical to cytochrome p460 expressed in N europaea This implies...
- 7
- 384
- 1
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... cleavage signal are present at the joint of some single- stranded and doublestranded regions, such as L1–S2 and S2–J1 ⁄ 2, suggesting that base pairing at these joint sites is dynamic (breathing) ... (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by RT-PCR was performed using the forward primer radiolabeled with [c-32P]ATP (Furui, Beijing, China) ... normalized intensity of RNase cleavage signals, and asterisks indicate RNase V1 signals in unpaired regions (B) Deduced secondary structure of the PRE-ISS RNA RNase T1, RNase V1 and RNase A signals...
- 14
- 379
- 0
Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx
... the Information System Audit and Control Association (ISACA), and international organisations such as the International Auditing and Assurance Standards Board (IAASB) or the Institute of Internal ... IS audit and the IT audit There are numerous publications of standards and guidelines as well as general literature available on the subject of audits, and in particular IT audits Such publications ... counteract the increasing threats to the availability, confidentiality, and integrity of information, business processes, applications, and systems The information security audit (IS audit) is part...
- 38
- 505
- 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
... St Lucia, St Vincent & the Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Barbuda, Dominica, Grenada, and Turks & Caicos in 2005 Clinical Skills ... in clinical skills, clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training http://www.human-resources-health.com/content/7/1/11 ... pursue additional training in instructional design to become a master trainer, which is the "top" of the trainer pathway Master trainers are able to design trainings and conduct advanced training...
- 8
- 450
- 0
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf
... treated and untreated OvCa cells decrease CCL25 also induced a gradual increase in Akt phosphorylation and 10 minutes after treatment Wortmannin treatment abrogated this increase, but CCL25treated ... CCR9-CCL25 signalling enhances OvCa survival and cisplatin resistance Specifically, we show that CCL25 induces robust activation predominately through the PI3K/Akt pathway and its downstream mediators, ... CCR9 signalling and survival mechanisms are independent of FAK activity Conflicting studies demonstrated cisplatin activates Akt in several cancer cell lines, which leads to cisplatin resistance...
- 8
- 316
- 0
Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf
... vegetation is subject to external environmental factors net such as soil and climate, and to inherent facsuch as age and the kind of tree cover (Santa Regina et al, 1991).Plants retain a substantial ... experimental site is located in the Sierra de la Demanda mountains in the province of Burgos and Logroño in northern Spain The topography is mountainous and its paleozoic massif is located ... mineralized, total carbon and nitrogen were determined using a Wosthoff carmograph and Macro-N Heraeus analyzer, respec- tively Data were treated with analysis of variance, considering trees belonging to...
- 9
- 261
- 0
báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx
... study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... Yoshida H, Mamada Y, Taniai N, Mizuguchi Y, Nakamura Y, Nomura T, Okuda T, Uchida E, Fukuda Y, Watanabe M, et al: Spurt bleeding from a calcificated gastrointestinal stromal tumor in the stomach ... Clin Imaging 1997, 21(2):122-125 Yasushi Itoua TRKaST: A case of intraductal tubular adenocarcinoma of the pancreas that developed extensive intratumoral calcification European Journal of Radiology...
- 4
- 231
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG ... NKG2D and its MIC ligands in rheumatoid arthritis Proc Natl Acad Sci USA 2003, 100:9452-9457 Kochi Y, Yamada R, Kobayashi K, Takahashi A, Suzuki A, Sekine A, Mabuchi A, Akiyama F, Tsunoda T, Nakamura ... Martinez A, Fernandez-Arquero M, Balsa A, Rubio A, Alves H, Pascual-Salcedo D, Martin-Mola E, de la Concha EG: Primary association of a MICA allele with protection against rheumatoid arthritis Arthritis...
- 11
- 460
- 0
báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx
... Robertsonian translocation In the other breeds investigated, this translocation was absent In an additional study of familial relationships it could be shown that all chromosomally aberrant A. I boars ... information about a IYAKE Robertsonian translocation in swine observed in a local unselected pig herd and in A. I boars in GDR reciprocal reciprocal II Materials and methods Blood samples were obtained ... from a local herd which had been studied However, it is remarkable that this type of aberration was found only in A. I boars of the Landrace Among 62 Landrace animals analysed, boars showed a heterozygote...
- 7
- 313
- 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx
... of it; those technically demanding operations are requiring team approach and a sound decision making process Maintaining optimal oxygenation through out the procedure is desirable There are various ... interests Authors' contributions HP participated in the sequence alignment and drafted the manuscript and VY participated in its design and coordination The authors read and approved the manuscript Author ... postoperative mortality was 12.5% in our series due to ARDS Mitchell et al [8] reported a 20% mortality for Carinal Pneumonectomy and 11% for carinal plasty The overall mortality is high and this...
- 7
- 311
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25