perform a full level 0 backup of the export home file system
THE MOON A FULL DESCRIPTION AND MAP OF ITS PRINCIPAL PHYSICAL FEATURES doc
... considerably north of the equator, and the Mare Imbrium, wholly confined to the northeastern quadrant, and including an area of about 3 40, 000 square miles These are by far the largest lunar "seas." The ... have caused them to swerve suddenly from their path, as in the case of the Ariadaeus cleft, and in that of one member of the Mercator-Campanus system Of the actual nature of the lunar rills we are, ... to an equally barren expanse on the north-west, to which they present a lofty face, having an average altitude of about 600 0 feet The loftiest peak, over 13 ,00 0 feet, rises west of Fermat _The...
- 338
- 398
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... Grewal RP Familial arachnoid cysts associated with oculopharyngeal muscular dystrophy Clin Neurosci 200 3; 10: 125-7 22 Orlacchio A, Gaudiello F, Totaro A, et al A new SPG4 mutation in a variant ... temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1 gene might play an important...
- 4
- 652
- 0
Tài liệu Future Flight: A Review of the Small Aircraft Transportation System Concept pdf
... consists of about 1 90, 000 aircraft, 5 ,00 0 airports open to the public, and 600 ,00 0 pilots In this chapter, an overview of the basic types of aircraft in the fleet, their uses in transportation, the system ... increase from about 400 to more than 1, 500 aircraft in 10 years (FAA 200 0b) Rotary-Wing Aircraft There are about 6, 900 rotary-wing aircraft in the U.S fleet (see Table 2-1) About 60 percent of these ... the past two decades In 19 80, 60 percent of the commuter fleet consisted of aircraft with fewer than 20 seats (FAA 1989; FAA 200 0b; RAA 1999; RAA 200 0) At the time, more than 200 commuter airlines...
- 135
- 2,350
- 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... Biotechnology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-terminal (Abcam) Analysis of GR was performed at : 100 0 dilution ... structure of chromatin incorporating them To see whether the increased transcription leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a ... However, TSA alone tended to induce transcription at a weak level, also in the absence of hormone (Fig 1C, compare lanes 1, and 5, and 9, 10) A further effect of TSA treatment was a significant reduction...
- 10
- 500
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... addition of 400 lL M Na2CO3 After centrifugation for 10 at 13 400 g, the A4 20 was measured b-Galactosidase activity was calculated in Miller units according to the formula: units ¼ 100 0 · A4 20/ (culture ... gene) and quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene) BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2 Activity values are given as mean values ± standard ... pair of primers: 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1...
- 10
- 464
- 0
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... semialdehyde dehydrogenase in the lysineA PA0266 2-Oxoglutarate B PA0265 Glutarate semialdehyde 5-Aminovalerate NADP+ Glutamate NADPH Absorbance at 3 40 nm 0. 20 a 0. 15 0. 10 0 .05 b c d 0 100 200 300 ... PA1583 PA1 600 PA1985 PA1 604 PA1 605 PA15 90 PA04 50 PA1629 PA0455 PA0854 PA0446 PA2556 PA2 401 PA1 606 PA2 400 PA22 50 PA1575 PA4333 PA1628 PA3416 lipoamide dehydrogenase-glc (EC 1.8.1.4) hypothetical protein ... 0. 425 0. 425 0. 425 0. 41 0. 41 0. 41 0. 415 0. 405 0. 4 0. 39 0. 39 0. 39 0. 395 0. 38 0. 38 0. 385 0. 37 0. 375 0. 36 0. 36 0. 365 0. 365 0. 35 0. 35 0. 35 0. 355 0. 355 0. 355 0. 34 0. 34 0. 3 PA1587 PA1591 PA1593 PA1585 PA1594...
- 12
- 441
- 0
A Concise History and Directory of the City of Norwich for 1811 pptx
... filled, appears to the best advantage, and then any person who has a taste for theatrical amusements, neatness and elegance, cannot fail being agreeably entertained with the appearance of the audience, ... expence of maintaining the poor of Norwich, has amounted to 20, 000 pounds on an average for the last 20 years, which has been raised by an assessment on the half rental of occupations, at about ... the habitation of 10 poor women being 60 years of age or upwards, of good character, and who had been inhabitants of the city at least 10 years Each of them in addition to their room are allowed...
- 116
- 532
- 0
Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx
... FEBS 200 3 } 2422 C Soti et al (Eur J Biochem 2 70) NAD affected the tertiary–quaternary structure of the Hsp 90 homolog of Neurospora crassa [22] Since the available data in the literature is rather ... or analogs were added at a final concentration of mM, if not otherwise indicated, and after an additional incubation of 15 at 37 °C affinity cleavage was induced by the addition of 0. 5 mM FeCl3 and ... in Hsp 90: a 70- kDa major Hsp 90 fragment (C 70) at the N-terminal binding site, and a 46-kDa major fragment (N46) at the C-terminal Hsp 90 nucleotide binding site ([ 20] and Fig 1A, lane 3) The C-terminal...
- 8
- 392
- 0
A Brief Memoir with Portions of the Diary, Letters, and Other Remains, potx
... Journal:-6th Mo 12th Many and great have been the favors dispensed within the last five weeks The attendance of the Yearly Meeting has been the occasion of many and solemn warnings and advices, and, ... says that no action can be purely abstract; and that as to uphold an immoral system is immoral, as the drinking system is immoral, as moderate draughts uphold the drinking system, and, in fact, ... wife of William Southall, Jr., of Birmingham, England, and daughter of John and Eliza Allen, was born at Liskeard, on the 9th of 6th month, 1823 As she felt a strong attachment to the scenes of...
- 95
- 517
- 0
A POLITICAL AND ECONOMIC DICTIONARY OF THE MIDDLE EAST potx
... in the inauguration of Hamid Karzai as chairman of the AIA on 22 December 200 1 The AIA held a nation-wide Loya Jirga in June 200 2, and Karzai was elected President by secret ballot of the TISA ... settle in Iraq, accepted the offer, and eventually became the leader of the National Command of the Iraqi Ba’ath Party African Union (AU) The AU replaced the Organisation of African Unity (OAU) in ... scene A political and economic dictionary of the middle east 22 Al-Ahbash The Association of Islamic Charitable Projects (Jami’at al-Mashari’ al-Khayriya alIslamiyya), known as al-Ahbash (‘the...
- 764
- 546
- 1
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... non-transf cells linTTV day1 bp 500 400 300 RT1R nt 683-6 60 pSTBlue-1 day6 D day 10 D day3 D Mw D 600 500 400 linTTV day3 D bp Mw +RT -RT R Circularization of the linear construct D 600 500 400 input ... ( 200 7) 4719–47 30 ª 200 7 The Authors Journal compilation ª 200 7 FEBS 4727 Biological activity of a full- length TTV DNA clone L Kakkola et al MA, USA) The BamHI- and BamHI ⁄ DpnI-digested DNA samples ... geminiviruses and plant circoviruses Arch Virol 143, 1723–1744 14 Okamoto H, Takahashi M, Nishizawa T, Tawara A, Sugai Y, Sai T, Tanaka T & Tsuda F ( 200 0) Replicative forms of TT virus DNA in bone marrow...
- 12
- 446
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... These included the insects D melanogaster (AAB 602 17), A gambiae (EAA06264), A aegypti (AAK158 10) , S invicta (AAP924 50) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), ... Ministry of Education and Science, Spain (projects BOS 200 2 -03 359 and AGL 200 2 -01 169) and the Generalitat de Catalunya ( 200 1 SGR 00 3245) is gratefully acknowledged L.C is recipient of predoctoral research ... developmental stages using the General Elute Mammalian TotalRNA kit (Sigma, Madrid, Spain) A 300 ng portion of each RNA extraction was DNAse treated (Promega, Madison, WI, USA) and reverse transcribed...
- 11
- 414
- 0
Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx
... Lanes and contain an aliquot from the anti-PU1 a nity chromatography purification step; lanes and contain an aliquot from the hydroxylapatite purification step; lanes and 2, silver-stained; lanes ... Tanigawa, Y (1995) Molecular cloning and characterization of a cDNA encoding monoclonal nonspecific suppressor factor Proc Natl Acad Sci USA 92, 3463–3467 10 Nakamura, M., Xavier, R.M & Tanigawa, ... enhance expression of Sp 100 , an autoantigen in primary biliary cirrhosis J Immunol 149, 406 7– 407 3 27 Xavier, R.M., Nakamura, M & Tsunematsu, T (1994) Isolation and characterization of a human...
- 7
- 272
- 0
A Theoretical and Empirical Assessment of the Bank Lending Channel and Loan Market Disequilibrium in Poland doc
... VI /01 Kernel Density (Epanechnikov, h = 6 .08 73) 50 0 .06 0. 05 40 0 .04 30 0 .03 20 0 .02 10 0 .01 94 95 96 97 98 99 00 01 0. 00 10 20 30 40 Source: National Bank of Poland and the authors calculations ... Correlations Between Loan and Intervention Rates, II/94 - II /01 0, 95 50 0,94 50 0,93 50 0,92 50 0,91 50 0, 905 0 0, 89 50 0,88 50 0,87 50 -4 -3 -2 -1 3-M onth Loan R ate - Intervention R ate 6-M onth Loan ... N (0, ) and where Dt denotes the annual growth rate of the demand for bank i loans, St the annual growth rate of the supply of bank loans and Qt the annual growth rate of the observed amount...
- 36
- 473
- 0
Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx
... to the extraposition cases, I will recast it in terms of a closely related automaton, the Bottom-up EPDA (BEPDA) ~ The BEPDA consists of a finite-state control and of a stack of stacks There are ... of moves: either an input is read and pushed onto a new stack on top of the stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and ... than an EPDA has two advantages: first, the data-driven bottom-up automaton represents a more intuitive model of human sentence processing than the top-down automaton; second, the grammar that...
- 3
- 354
- 0
Báo cáo khoa học: Hypoxia induces expression of a GPI-anchorless splice variant of the prion protein potx
... Jakob disease based on molecular and phenotypic analysis of 300 subjects Ann Neurol 46, 224–233 Kikuchi Y, Kakeya T, Sakai A, Takatori K, Nakamura N, Matsuda H, Yamazaki T, Tanamoto K & Sawada ... transmembrane collagen XVII and leads to intracellular accumulation J Biol Chem 281, 302 60 302 68 25 Campana V, Caputo A, Sarnataro D, Paladino S, Tivodar S & Zurzolo C ( 200 7) Characterization of the properties ... variant in human Alzheimer’s disease brain tissue J Neurochem 72, 2498–2 505 29 Matsuzaki S, Manabe T, Katayama T, Nishikawa A, Yanagita T, Okuda H, Yasuda Y, Miyata S, Meshitsuka S & Tohyama M...
- 12
- 447
- 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc
... 0. 30 0.32 0. 58 0. 53 0. 36 0. 37 0. 50 0.52 0. 33 0. 26 0. 61 0. 42 0. 54 0. 40 0.58 0. 45 0. 39 0. 29 0. 62 0. 46 0. 50 0.37 0. 42 0. 34 0. 11 0. 66 Phys fitness 0. 40 0.26 0. 26 0. 26 0. 65 0. 51 0. 46 0. 37 0. 16 0. 20 0.18 ... Manag COOP/WONCA Coop./ comm Senses 0. 74 0. 60 0.54 0. 47 0. 63 0. 54 0. 44 0. 48 0. 40 0. 30 0.34 0. 32 0. 33 0. 36 0. 42 0. 76 0. 76 0. 76 0. 60 0.83 0. 76 0. 38 0. 25 0. 27 0. 57 0. 54 0. 36 0. 37 0. 51 0. 56 0. 28 0. 24 ... 0. 0 0. 5 0. 3 0. 3 0. 0 0. 7 0. 1 0. 3 0. 1 0. 2 0. 1 0. 5 37 1.9 1.5 1 .07 1.15 94.2 90. 9*** 0. 2 0. 4 38 39 2 .0 2 .0 1.6 1.9 1 .05 1 .05 1 .04 1 .09 1. 10 1 .09 94.7 96.1 96.8 91.3 93 .0* ** 94 .0* ** 0. 0 0. 0 0. 3 0. 0...
- 9
- 489
- 0
báo cáo hóa học:" Arthroscopic debridement of the osteoarthritic knee combined with hyaluronic acid (Orthovisc®) treatment: A case series and review of the literature" docx
... patellofemoral joint had the greatest amount of involvement with an average grade of 3.1 +/- 0. 5 The medial compartment revealed an average ICRS grade of 2.8 +/- 0. 8 and the lateral compartment ... and lateral femoral tibial joint were systematically evaluated All compartments were graded using the ICRS grading scale: Grade I was assigned to cartilage that appeared nearly normal and had superficial ... patients carried a preliminary diagnosis of osteoarthritis (via MRI and plain radiograph) and were candidates for primary arthroscopic treatment of a unilateral knee secondary to a meniscal pathology,...
- 8
- 709
- 0
A Different World: Financial Audits of the Legislative Branch ppt
... Standards and Regulations OMB vs SEC (PCAOB) FASAB vs FASB GAGAS vs GAAS FISCAM vs CobiT Timing Calendar year vs Federal fiscal year This is trial version www.adultpdf.com Financial Audits of the ... Trends Financial Statements Format GAAP Federal GAAP OCBOA (modified accrual or cash basis of accounting) This is trial version www.adultpdf.com Financial Audits of the Legislative Branch Current ... Office Other GAAP (CY) N /A OCBOA (FY) FED GAAP (FY) FED GAAP (FY) GAAP (FY) FED GAAP (FY) N /A This is trial version www.adultpdf.com Financial Audits of the Legislative Branch Compliance Requirements...
- 14
- 214
- 0
báo cáo hóa học:" Isolated thumb carpometacarpal joint dislocation: a case report and review of the literature" potx
... GA: Bilateral carpometacarpal dislocations of the thumb Am J Orthop 200 3, 32:38-41 11 Kural C, Malkoc M, Ugras AA, Sen A: Isolated carpometacarpal dislocation of the thumb: a case report Acta ... trapezium and trapeziometacarpal joint J Hand Surg [Am] 1999, 24(4):786-798 Strauch RJ, Behrman MJ, Rosenwasser MP: Acute dislocation of the carpometacarpal joint of the thumb: an anatomic and cadaver ... anchor loaded with a 2 -0 suture material (Ethibond) Furthermore, the CMC joint capsule was repaired in an Page of Figure Intraoperative photograph of the dorsal aspect of carpometacarpal joint The...
- 5
- 445
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25