... Communities, ISBN 978-92-79-06902-4 Chandra Shah & Michael Long (2007) Labour mobility and mutual recognition of skills and qualifications: European Union and Australia/New Zealand MONASH UNIVERSITY, CENTRE ... between the linguistic and intercultural competence of graduates and the real needs of the labour market, the curricula of language and intercultural training must be based on real workplace needs; ... in economic, political and social context in the age of globalization, there are now definitely new and growing linguistic needs and demands around the world in general and in Vietnam in particular...
... All States + DC and PR 19 Table A.10 – Number and Percent of Bridges with Main Span Material of RC, PS, Steel and Timber by System and Span Length – All States + DC and PR ... – Deck Area and Percent of Bridges with Main Span Material of RC, PS, Steel and Timber by System and Year Built – All States + DC and PR 21 Table A.12 – Deck Area and Percent ... main and approach spans, deck width, skew • Material and structure type for main span and approach spans, if any • Condition and appraisal ratings of structure • Traffic data Material Usage and...
... correlates with drug hydrophobicity (repulsion of drug by water) Binding to plasma proteins is instantaneous and reversible, i.e., any change in the concentration of unbound drug is immediately ... elimination Plasma concentration Plasma concentration Free drug Bound drug Free drug Time A Importance of protein binding for intensity and duration of drug effect Lüllmann, Color Atlas of Pharmacology ... types of drugs Drugs exchange freely between blood and interstitium in the liver, where endothelial cells exhibit large fenestrations (100 nm in diameter) facing Disse’s spaces (D) and where...
... second (and therefore not tabulated) were listed and each was classified intuitively as a member of one of the five article-pattern classes Once again the first half of the corpus was tested, and ... criterion: "Is the English noun token singular or plural?" To test the significance and power of these two criteria, and to gauge the strength of additional criteria that might be necessary, the following ... made for a noun if it had occurred in the text both with and again without a following genitive block behind its Russian equivalent), and (f) the tabulation was examined for possible clues to...
... around and to act out different roles The atmosphere in the classroom is less formal and this can reduce tension Prepare students for real life and unpredictability: Real life situations and communication ... risks without fear of harm to realpeople or real events, and they are free to learn from mistakes In addition, when learning how to communicate in a target community, realistic experiences are essential ... Mimicry of real life” is legitimate for actors in role play and drama but not for participants in a simulation In the debriefing all participants should be able reasons for their behavior and not...
... attitudes, beliefs, and behavior of peopleand their settings through questionnaires administered by mail, handouts, personal and, telephone interviews, and the Internet According to Cohen and Manion ... with real tests, self-evaluate their strengths and weaknesses in IELTS study, and consider whether their practice materials currently suit their ability and meet first-year linguistic demands ... Speaking and Writing), and English for Specific Purposes in the third and fourth years Based on this, both teachers and students are aware of the importance of general English in the first and second...
... edges by virtue of miscommunication and propaganda In order to avoid this ignominious cultural and political disintegration, and foster empathy and understanding, teachers should present students ... trying to identify and gain insights into the very fabric of society and culture that have come to charge language in many and varied ways can only cause misunderstanding and lead to cross-cultural ... the different views and perspectives of people in different cultures which may enhance or even inhibit communication After all, communication requires understanding, and understanding requires stepping...
... in food handling, storage and preparation practices; and • The growing movement of people, live animals, and food products across borders, which causes disease to spread more widely and more ... materials and final seafood products before they are exported, and they also issue rules and make policies and regulations that are related to fishery hygiene and safety in general and shrimp ... regarding the safety of food supply in general and high-risk products in particular Consumers and governments are demanding safe food, and these demands are being passed back along each step of...
... greatly expanded to the west and southwest The spatial growth of Hanoi is limited by natural barriers, such as streams to the northeast and east, water bodies to the north, and wetland to the ... University), Linh Dam area which was originally wetland and agriculture, has became a modern New Town, combined to the “natural” landscape and green space, and created a motivation for the development ... with a vision toward 2050 and location of Linh Dam project (the red point) Westward expansion has been draft by the Vietnamese Institute of Urban and Rural Planning and will form the basis on...
... aromatic hydrocarbons, etc in S Typhimurium TA strains YG1041 and YG1042 have 50-100 times respectively higher levels of both NR and OAT enzyme activity than their host strains TA98 and TA100 ... (1041, 1042) and their host TA strains (98, 100) 2-Nitrofluoranthene, 1-nitropyrene and 1,8-dinitropyrene are tested without S9mix, Glu-P-1 and Trp-P-2 are tested with S9mix using TA98 and YG1041 ... 2,4-dinitrotoluen and 4-nitroquinoline N -oxide (4-NQO) are tested without S9mix, 2-aminoanthracene and benzo[a]pyrene are tested with S9mix using TA100 and YG1042 nitropyrene and 1,8-dinitropyrene...
... et al., 2003), and the wastewater is reclaimed as a drinking water source in two scenarios A-1 and A-2 In scenario A-1, the wastewater reclamation covers half of the shortage of drinking water ... Science and Technology (MEXT) in the project of Symbiosis of Human, Nature and the Earth under Research Revolution 2002 (RR2002) and Japan Society for the Promotion of Science (JSPS), Grand-in-Aid ... No.2, 2005 Rose, J B and Gerba, C P (1991) Use of risk assessment for development of microbial standards Wat Sci and Tech., Vol.24, No.2, 29-34 Tambo, N (1983) Water supply and trihalomethanes,...
... #!!(),)## 1.23452/0267/8 '"# Figure Band intensities for Nitrobacter species While in Figure 4, the band intensities were high only in Runs and 7, and their band intensities were quite similar, ... with PCR and FISH By both of PCR and FISH analyses, only Nitrobacter species were detected The PCR result with FGPS primer set is shown in Figure The band intensitis were quantified, and were ... CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r...
... with the Japanese Industrial Standard and analyzed by CVAAS (HG-200, Hiranuma) A mercury standard was made from mercury (II) chloride and checked against Hair Standard no 13, obtained from the ... ng/mg dry wt., and those in samples from the tributaries (st 101, 401, 402, 403, 501, 1101, and 1201) ranged from 0.003 to 0.095 ng/mg dry wt (Fig 5) The sediments in both the main river and its ... H and Takahashi, H 2004 Deposition of Wash Load Observed in Kahayan and Rungan Rivers Annual Report for April 2003 – March 2004 on Environmental Conservation and Land Use Management of Wetland...
... Giant Reed, Reed, and Silver Grass - 144 - Journal of Water and Environment Technology, Vol 7, No 2, 2009 Fig - Carbon and Phosphorus Cycles System Using the Giant Reed MATERIALS AND METHODS Giant ... [day], C0 and Cn (C0 ≠ Cn) are the concentration of phosphorus in culture medium when t=0 and t=n, respectively, and Δt is the time elapsed [day] From this equation, the parameters Imax and Km were ... roots and rhizomes are cropped except for the roots and rhizomes remaining for the next year Thereafter, the giant reeds grow with the rhizome extension, and the giant reed community in the wetland...
... contact people receive and their degree of participation in group communication in the number of turns taken in a group conversation for example The NLP approach to eye contact is holistic and ... good eye contact increases rapport Save time and effort with specific messages delivered by eye and facial expression Show praise, encouragement often, and disapproval occasionally Remind learners ... correction technique Nominate and invite responses by eye If the nominee is not watching, someone will give him/her a nudge Eye contact is, fundamentally, time and effort saving Much of the above...
... one another and share their experiences, conceptions and beliefs” Culture is a shared, learned, symbolic system of values, beliefs and attitudes that shapes and influences perception and behavior ... embodies, and symbolizes cultural reality and in return cultural knowledge makes language alive Therefore, they co-exist and support each other The idea of the world is captured by culture And language ... students get deep understanding of both English cultures and their own, they are better ready to speak English or encounter real situations Facts have shown that culture and language are two sides...
... portable cabinet for candidates taking the Mandarin examinations The translation of the concept ‘tủ sách thầy đồ’ is really clear and easy to understand ‘Candidates taking the Mandarin examinations’ ... macaques, guenons, and tamarins, but exclude apes, lemurs, and tarsiers Clearly, the two concepts ‘vượn’ and ‘monkey’ are totally different; however, in Vietnamese people s thought, ‘vượn’ and ‘monkey’ ... function was ‘to provide officers and administrators’ Generally, description and function are essential elements in translation I.4.12 Reduction and expansion Reduction and expansion are rather imprecise...