pass two dimensional array to function in c
Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc
... involved in the interaction with Dys-1 in vitro Within this domain, the first half seems to be particularly critical as deletions infringing on this side lead to a decrease in binding Constructs ... amino acids (Fig 5), rescue of dyb-1(cx36) animals still occurred in two out of three lines transgenic lines (Table 1), which indicates that removing introns and did not impair the rescuing capacity ... Dyb-1 for in vitro binding experiments Deletions were carried out on the dyb-1 coding sequence, using clone AN450 [encoding Dyb-1 amino acids 390–543 fused in frame to the GST coding sequence; plasmid...
- 6
- 334
- 0
Báo cáo hóa học: " Two-dimensional downlink burst construction in IEEE 802.16 networks" ppt
... applied to determine the optimal connection-subchannel match Chen et al [4] proposed the dynamic frequency selection approach, in which each connection selects its subchannel according to the ... function FindMCS(i,j,h) calculates the MCS used by the burst located in the corner j with the height h BCO evaluates the burst constructed in each corner by the NOSCal, MCSCal, and ThCal functions ... optimal corner by virtually constructing the burst in each corner to address the optimal block exploration (line 6-13), i.e., BCO repeatedly invokes the ConstructBurst function to virtually construct...
- 18
- 349
- 0
ELECTRICAL CHARACTERIZATION OF TWO DIMENSIONAL CARBON AND VO2 IN ULTRAHIGH VACUUM
... of 2D carbon to study the dependence of FE characteristics on the anode -to- cathode distance It was found that the field enhancement factor increases with increasing anode -to- cathode distance An ... ACRONYMS 1D One -dimensional 2D Two- dimensional 2DEG Two- dimensional free electron gas AC Alternating current AFM Atomic force microscopy CNS Carbon nanosheets(s) CNT Carbon nanotube(s) CNW Carbon nanowall(s) ... frequency increases with the bias current and/or with decreasing device dimension In contrast to most VO2-based oscillators reported to date, which were electrically triggered, current-induced Joule...
- 135
- 319
- 0
báo cáo khoa học: " Evaluation of protein pattern changes in roots and leaves of Zea mays plants in response to nitrate availability by two-dimensional gel electrophoresis analysis" pdf
... http://www.biomedcentral.com/1471-2229/9/113 Figure Total proteins, amino acids, reducing sugars, sucrose and chlorophyll content Total proteins, amino acids, reducing sugars, sucrose and chlorophyll content Time course ... of PCA and then centrifuged again in the same conditions KOH was added to the collected supernatant (to pH 7.6) to remove excess PCA Reducing sugars were measured according to the colorimetric ... of GF14-12, for which the functional information are still lacking Thiamine (i.e vitamin B1) is required in many pathways, such as the Calvin cycle, the branched-chain amino acid pathway and pigment...
- 17
- 325
- 0
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx
... 5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCTGAAGAA GATCTGATGGCAGCACCCACG 3' and 5'-CGTGGGTGCTGCCATCAGATCTTCT TCAGAAATAAGTTT TTGTTCCATTCAGCCCAAAGCTGG-3' MuPAR regions were introduced into the c- myc HuPAR2 or HuPAR2eGFP backbone ... and 5'-GACCCAGGAAGAAAGACCGTAAG-3' (reverse); HuPAR2 probe, 5'-FAM TTCCTGAGCCACCTGCCACCTCCT BHQ3' Final reaction concentrations were 200 nM probe and 300 nM primers in 20 μl total reaction volume ... 5'-FAM TTCTTGAGCCACCTGCCACCTCGC BHQ-3' Underlined nucleotides represent differences between HuPAR1 and HuPAR2 in this region HuPAR2 primers and probe used were 5'-GCCTGTTGTACCTCTAATGTCACT-3' (forward)...
- 15
- 330
- 0
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
... Global longitudinal strain measured by two- dimensional speckle tracking echocardiography is closely related to myocardial infarct size in chronic ischaemic heart disease Clin Sci (Lond) 2007; ... strict protocol we had to exclude segments in which the tracking failed (feasibility 71%) One could also criticize the intra-individual comparison instead of considering a control group In our ... Conclusions Velocity Vector imaging (VVI) is a clinically feasible approach for strain measurements in infarcted myocardium allowing an accurate assessment of global and regional myocardial function, ...
- 8
- 683
- 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
... Metabolic gene switching in murine female heart function [8] Likewise, high fatty acid oxidation rates in the diabetic heart results in reduced cardiac efficiency [9] In addition to its cytoplasmic ... (2001) Intrinsic diurnal variations in cardiac metabolism and contractile function Circ Res 89, 1199–1208 19 Sordahl LA, Besch HR Jr, Allen JC, Crow C, Lindenmayer GE & Schwartz A (1971) Enzymatic ... Sack MN (2004) Hypoxia-induced decrease 5284 of UCP3 gene expression in rat heart parallels metabolic gene switching but fails to affect mitochondrial respiratory coupling Biochem Biophys Res Commun...
- 7
- 582
- 0
Báo cáo khoa học: "A Grammatical Approach to Understanding Textual Tables using Two-Dimensional SCFGs" docx
... USA, 2002 ACM Press Conclusion We have introduced a framework to support a more linguistically-oriented approach to finer interpretation of tables, using two- dimensional stochastic CFGs with Viterbi ... likely interpretation was predicted even without access to speci c lexical knowledge We aim to show that a fairly useful baseline level of semantic interpretation accuracy can already be achieved, ... unable to show both physical structure and the semantics of a table at the same time in a hierarchical manner In contrast, information such as “a data block contains three rows of data cell” can...
- 8
- 482
- 0
Base Tutorial: From Newbie to Advocate in a one, two... three! pot
... deciding on class structure (which classes to work with and which attributes to record in each) and the structure of connections they establish (which table connects with which and with what cardinality) ... if you want to have access to expanded character sets: Chinese or Arabic characters, accented vowels (diacritics) and things like that Protocols that allow for lager numbers of characters have ... discover how much thinking goes into designing the tables and their connections Compared to such effort, actually building them can seem almost trivial Once you have the logical structure, you can...
- 189
- 1,619
- 0
Báo cáo Y học: Evaluation of two biosynthetic pathways to d-aminolevulinic acid in Euglena gracilis potx
... [2-1 3C] acetyl CoA (8iii) into the TCA cycle 1 3C- Labeled positions of succinyl CoA (cccc) (5ii to 5vii) are those of the product formed by reversion from succinic acid Numbers shown under (ccccc) ... [2-1 3C] acetyl CoA (8i to 8iii) derived from D[1-1 3C] glucose (ccccc) represents a-ketoglutaric acid (7i to 7v), (cccc) represents succinyl CoA (5ii to 5vii), and (cc) represents acetyl CoA (8i to 8iii) (c) ... Succinic acid labeled with 1 3C on C- 4 and C- 1 can revert to succinyl CoA (5iv and 5v), giving rise to succinyl CoA (5iv and 5v) labeled with 1 3C on C- 4 and C- 1 in equal quantity Part of succinyl...
- 7
- 504
- 0
Báo cáo khoa học: "A TWO-WAY APPROACH TO STRUCTURAL TRANSFER IN MT" potx
... of a canonical clause structure The original impetus for using a canonical structure w u the need for an efficient analy,,ds of the German clause However, this canonical structure is put to use ... history, they comprise an independent portion of the system and 71 are invoked by instructions in target packages Transfer rules are stored according to one or more root categories Rules pertaining ... manuscript, 1985 CLS-SUB LCL RCl CLS-REL (AND ( I l c r I m3 DID SUB) i f PREDicate is INDicative or S U B j u n c t i m MooD (XFM move S U B j e c t in front o f PREDicate C/ E:1 (PRED:2 - : CNP:4...
- 3
- 303
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... exposing CD4+ T cells to both IL-2 and rapamycin in vitro leads to an increase in the cellular frequency of FOXP3+ T cells, originating from nTreg cells and de novo induced Treg cells [91] Clinical ... apoptosis due to a deficiency of IL-2 in inflammatory sites [10] Hence, IL-2 may function as critical an anti-apoptotic factor for Treg cells Evidence of Treg deficiencies in human T1 D It is unclear ... including CD4+ regulatory T cells (T reg) cells [2] These cells constitute 1-10% of * Correspondence: ciro.piccirillo@mcgill.ca † Contributed equally FOCIS Center of Excellence, Research Institute...
- 12
- 573
- 0
báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf
... http://www.occup-med.com/content/3/1/6 atory volume in one second (FEV1) and forced expiratory capacity (FVC) were recorded in accordance with American Thoracic Society guidelines (24) Lung function data ... we examined exposure-response relations between the acumulated exposures during followup according to the specific welding technology We also examined decline in lung function according to exposure ... decline in lung function according to our Table 3: Full shift average exposure to welding fume particulates measured in air samples collected among 44 randomly selected welders in 1987 in comparison...
- 8
- 437
- 0
báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pdf
... pain and inability to return to normal activity Figure A comminuted complex intertrochanteric fracture occurring due to the patient falling from his bicycle The acetabular component was retained ... logical to avoid cobalt chrome components in the bearing couple when revising for this indication While it is too early to comment on the clinical outcomes of these prostheses, the main determinants ... occupational work Active Regularly participates in active events such as bicycling, aqua-aerobics Gardening or working out in the gym once or twice a week Very active: Regularly participates in...
- 6
- 305
- 0
báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pptx
... pain and inability to return to normal activity Figure A comminuted complex intertrochanteric fracture occurring due to the patient falling from his bicycle The acetabular component was retained ... logical to avoid cobalt chrome components in the bearing couple when revising for this indication While it is too early to comment on the clinical outcomes of these prostheses, the main determinants ... occupational work Active Regularly participates in active events such as bicycling, aqua-aerobics Gardening or working out in the gym once or twice a week Very active: Regularly participates in...
- 6
- 359
- 0
Franchising and Licensing Two Powerful Ways to Grow Your Business in Any Economy_2 pdf
... both in their fields and as quality instructors and coaches The training program should incorporate appropriate technologies, such as interactive CD-ROM, training videos, Electronic Data Interchange ... training agenda from the UFOC of a restaurant franchisor Franchisees Training Agenda Topics to Be Covered Instructional Material Hours of Classroom Training Hours of On the Job Training Instructor ... timekeeping, vacancies, sick pay, time off, training, payroll taxes, law concerning employees, rules of conduct for employees, bulletin boards, and required notices Record Keeping and Accounting Collections...
- 30
- 383
- 0
Franchising and Licensing Two Powerful Ways to Grow Your Business in Any Economy_3 potx
... also can be given limited access to the Intranet to facilitate their interaction with the system An Intranet can also provide a secure central point for collecting financial information in order to ... manufacturer and distributor of chicken seasoning, counterclaimed against KFC, alleging unlawful tying of its KFC franchises to the purchase of its own special KFC seasoning exclusively from two ... price The inquiry typically focuses on coercion by the manufacturer The Great Clips court addressed the practice of offering discounts and coupons in the context of examining the franchisor’s control...
- 30
- 302
- 0
Franchising and Licensing Two Powerful Ways to Grow Your Business in Any Economy_5 doc
... interruption insurance, vehicle liability insurance and, where possible, terrorism protection insurance Larger franchisees should be encouraged to carry officer and director liability insurance Typically ... Security Interest In order to secure prompt payment of all amounts due to Franchisor hereunder, the Purchaser grants Franchisor a security interest in Purchaser’s accounts receivable, contract ... forth in the Price Schedule attached hereto as Exhibit A and incorporated herein by this reference The Price Schedule may be changed by Franchisor from time to time in the normal course of business...
- 30
- 285
- 0
Franchising and Licensing Two Powerful Ways to Grow Your Business in Any Economy_8 ppt
... discourage franchising specifically, the attitude toward foreign investors seeking to penetrate local markets through master or direct franchising is subject to a balancing of competing policy ... industry publications; (5) meeting with key suppliers and customers to understand industry trends and preferences; (6) buying the products of competitors to observe pricing, packaging, labeling, ... needed to operate the underlying franchised business The franchisor may want to consider what changes in the system may be feasible to accommodate this resources challenge without sacrificing the core...
- 30
- 382
- 0
Franchising and Licensing Two Powerful Ways to Grow Your Business in Any Economy_9 pptx
... preferred stock can be structured to offer to an investor, such as convertability into common stock, dividend and liquidation preferences over the common stock, antidilution protection, mandatory or ... direct and indirect costs and fees in connection with the debt financing Included in this category are closing costs, processing fees, filing fees, late charges, attorneys’ fees, out-of-pocket expense ... protect the upside by including warrants to purchase common stock at favorable prices and terms The use of a warrant enables the investor to buy common stock without sacrificing the position as a creditor,...
- 30
- 400
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25