pacific white shrimp litopenaeus vannamei culture in southern brazil effects of stocking density and a single or a double crop management strategy in earthen ponds
effects of magnesiumphosphoruspotassium containing in water on molting, growth and survival rate of the white shrimp (litopenaeus vannamei) juveniles, reared in low salinity water
... beginning in 1996, L vannamei was introduced into Asia on a commercial scale This started in Mainland China and Taiwan Province of China and subsequently spread to the Philippines, Indonesia, ... 20-10-10 a 14 12 10 a a a a a 40-20-20 a 1st a a a 2nd a a Mean of molting interval Molting interval Fig.5: Molting intervals of white shrimp (L .vannamei) 4.2.2.2 Weight gain of white shrimp after ... C.E., and Rouse, D.B., 2005 Effects of potassium, magnesium, and age on growth and survival of Litopenaeus vannamei postlarvae reared in inland low salinity well waters in west Alabama Journal of...
- 70
- 427
- 0
effects of light intensity on formation of bioflocs, water quality, growth performanceof white leg shrimp (litopenaeus vannamei) postlarvae in super intensive rearing tank
... created by adding g soybean meal and g wheat flour per tank Wheat flour and soybean mealwas heated in 60oC in autoclave, and incubated at room temperature for 48 hours before adding to the tanks ... C,E, and Bartholomew W, Green, 200 2a, Coastal water quality monitoring in shrimp areas: An Example from Honduras, Report of the World Bank, NACA, WWF FAO consortium progam on Shrimp farmming and ... Prof.PhD Tran Ngoc Hai Sign of Student Pham Thanh Nhan EFFECTS OF LIGHT INTENSITY ON FORMATION OF BIOFLOCS, WATER QUALITY, GROWTH PERFORMANCE OF WHITE LEG SHRIMP (Litopenaeus vannamei) POSTLARVAE IN...
- 26
- 450
- 0
Báo cáo khoa học: Antimicrobial activity of histones from hemocytes of the Pacific white shrimp ppt
... methods Animal handling L vannamei individuals were obtained from Waddell Mariculture Center, Bluffton, SC, USA They were transported to the laboratory in oxygen-saturated water and bled within h of ... Histone H2B protein has been reported as having antimicrobial activity in the channel catfish skin [20], in human placenta [24], and in murine macrophages [35] Also, an active fragment of histone H2B ... lysate proteins Molecular markers are indicated on the left in kDa Histone proteins and hemocyanin protein bands indicated on the right containing fractions Direct MALDI MS analysis of the unfractionated...
- 9
- 373
- 0
super intensive culture of white leg shrimp (litopenaeus vannamei), in recirculating tank system at different stocking densities
... Balakrishnan Soundarapandian Peyail Kumaran Ramachandran., Anand Theivasigamani., Kotiya Anil Savji Maheswaran Chokkaiah and Pushparaj Nataraj,2011 Growth of Cultured White Leg Shrimp Litopenaeus Vannamei ... Ramachandran, Anand Theivasigamani, Kotiya Anil Savji, Maheswaran Chokkaiah and Pushparaj Nataraj (2011) Growth of cultured white leg shrimp (Litopenaeus vannamei Boone, 1931) in different stocking ... www.euraquaculture.info/, SUSTAINAQUA, www.sustainaqua.com; SUSTAINAQ www.sustainaq.net; AQUAETREAT www.aquaetreat.org) to identify the most relevant sustainability issues for RAS, to quantify sustainability...
- 50
- 788
- 1
ẢNH HƯỞNG CỦA ĐỘ KIỀM LÊN QUÁ TRÌNH TĂNG TRƯỞNG CỦA TÔM THẺ CHÂN TRẮNG (Penaeus vannamei) ĐƯỢC NUÔI Ở ĐỘ MẶN THẤP (4‰) EFFECT OF ALKALINITY ON GROWTH PERFORMANCE OF WHITE LEG SHRIMP (Peneaus vannamei) CULTURED IN LOW SALINITY AREA (4‰)
... Low salinity Culture Of The Pacific White Shrimp Litopenaeus Vannamei University Of Puerto Rico Mayagüez Campus Davis D A. , Samocha T M and Boyd C E., 2004 Acclimating Pacific White Shrimp, Litopenaeus ... Institute Briggs, M., S Funge-Smith, R Subasinghe and Phillips, M 2004 Introduction and movement of Penaeus vannamei and Penaeus stylirostris in Asia and the Pacific Food and Agriculture Organization ... state based on length and weight Aquaculture 283, 13–18 Brock J .A and Main K.L., 1994 A Guide To Common Problems And Diseases Of Cultured Penaeus vannamei The World Aquaculture Siciety The Oceanic...
- 9
- 1,127
- 8
Báo cáo y học: "The role of F1 ATP synthase beta subunit in WSSV infection in the shrimp, Litopenaeus vannamei" potx
... nucleotide-binding domain, ATP synthase alpha/ beta chain N terminal domain, ATP synthase alpha/beta chain C terminal domain according to the NCBI Conserved Domain Database website This indicated that ... ELISA binding assay Graph showing decreasing absorbance that resulted when increasing rBP53 was added to compete with CMP in the ELISA assay for WSSV binding activity Error bars indicate standard ... alternative strategy for the first time in shrimp, Sritunyalaksana et al [8]showed that administration of the host VP28-Binding protein PmRab7 ( or an antibody against it ) could reduce and delay mortality...
- 9
- 363
- 0
Báo cáo sinh học: " Quantitative genetics of taura syndrome resistance in pacific white shrimp (penaeus vannamei): a cure model approach" pot
... death or censoring For each period, an individual was scored as dead (= 1) if it was recorded as dead during that period and as alive (= 0) otherwise, e.g., an animal dying at day had survival ... TG and CP were responsible for recording of data and challenge-test protocols, MHY was responsible for data management and editing, MR coordinated the project and BG and THEM participated in ... that treat survival as a binary trait For classical longitudinal survival models, high mortality (and thus limited censoring) would be an advantage in genetic analysis [9] Furthermore, the practice...
- 7
- 286
- 0
Optimization of chitin and chitosan extraction from by product from white leg shrimp (penaeus vannamei) industry in vietnam to improve its quality and efficiency
... composition among three parts of shrimp and most of essential amino acids were present Glycine/Arginine, Glutamic/Glutamine, Aspartic/Asparagine, and Alanine predominated of the amino acid profile ... significances and innovations - The data of the composition of chemicals, amino acids, minerals and heavy metals of three main parts of white leg shrimp (heads, shell and meat) as well as the effects ... Table 3.20 revealed that all of NaOH concentration, time and temperature as well as interaction of temperature and time, interaction of concentration and time and interaction of temperature and...
- 24
- 1,037
- 1
effects of chitosan on flocculation of chaetoceros algae and ability to apply on blood cockle (anadara granosa) and white leg shrimp (litopenaeus vannamei) rearing
... THU THAO Can Tho, December 2014 EFFECTS OF CHITOSAN ON FLOCCULATION OF CHAETOCEROS ALGAE AND ABILITY TO APPLY FOR REARING BLOOD COCKLE (Anadara granosa) AND WHITE LEG SHRIMP (Litopenaeus vannamei) ... The density of algae was determined the density times a week to assess filtration rate before and after feeding Statistical analysis: data were analyzed for mean value, standard deviation by using ... CAN THO UNIVERSITY COLLEGE OF AQUACULTURE AND FISHERIES EFFECTS OF CHITOSAN ON FLOCCULATION OF CHAETOCEROS ALGAE AND ABILITY TO APPLY ON BLOOD COCKLE (Anadara granosa) AND WHITE LEG SHRIMP (Litopenaeus...
- 15
- 370
- 0
the effects of probiotics on quality postlavae of white leg shrimp (litopenaeus vannamei)
... Amaya, E A. , D A Davis and D B Rouse 2007b Alternative diets for the pacific white shrimp (Litopenaeus Vannamei Aquaculture 262:419-425 Balakrishnan, G., S Peyail., K Ramachandran., A Theivasigamani., ... (Litopenaeus vannamei boone, 1931), 1-150 In Báo cáo Đề tài cấp Bộ FAO 2003 Larval health management, in: Health management and biosearity maintenance in white leg shrimp ( Litopenaeus vannamei) ... to Asia to supply its increasing demand (1.9 kg/capita in 2004) Major suppliers to the United States of America in 2005 were Thailand, Ecuador, India, China, and VietNam However, the rapidly increasing...
- 41
- 483
- 0
Báo cáo nghiên cứu khoa học " CLAM CULTURE DEVELOPMENT IN THE INTERTIDAL AREA: EFFECTS OF STOCKING BIOMASS ON GROWTH, SURVIVAL AND PRODUCTION OF THE TWO SIZES CLAM Meretrix lyrata " docx
... intertidal areas, the natural feed and environmental factors are uncontrollable and are dependent on nature Dynamics of tide, wave and current create the availability of algae, organic matter that are ... higher mortality, because of the quality of substrata or predators (Cigarr a and Fernandez, 2000) and the normal stocking size of this species for intertidal cultivation was 1.0 cm (Zhang, 2006) In ... and Wf are mean of initial weight and final weight, respectively and t is number of experiment days Size variation of the clam was evaluated according to Wang et al (1998) in which the mean of...
- 9
- 443
- 0
Báo cáo khoa học: "Effects of Protein Source and Energy Substrates on the In Vitro Development of Bovine Embryos in a Two-step Culture System" ppsx
... formation According to Liu and Foote [14] nonessential amino acids (NEAA) have a stimulatory effect upon all developmental stages, and essential amino acids (EAA) enhance blastocyst formation and ... generally been incorporated into designing culture media for pre-implantation embryo development, which is almost always comprised of a single formulation for all stages [20] Many have investigated ... Lee, E S and Fukui Y Synergistic effect of alanine and glycine on bovine embryos cultured in a chemically defined medium and amino acid uptake by in vitro produced bovine morulae and blastocysts...
- 6
- 514
- 0
Báo cáo y học: " Effects of the K65R and K65R/M184V reverse transcriptase mutations in subtype C HIV on enzyme function and drug resistance" pps
... 57D(5'GTTGGGAGTGAATTAGCCCTTCCAGTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGA-3' 17D 5'-TTAAAAGAAAA GGGGGG-3' 19D 5'-TTAAAAGAAAAGGGGGGAC-3' An HIV-1 RNA template spanning the 5' UTR to the primer binding site (PBS), was ... on TFV-binding and incorporation, we measured the steady-state kinetic constant Km for dATP and inhibition constant Ki for TFV-DP (Table 1) The steady state Km value of K65R RT for dATP was slightly ... Efficacy and safety of tenofovir DF vs stavudine in combination therapy in antiretroviral-naive patients: a 3-year randomized trial Jama 2004, 292:191-201 Lanier E, Scott J, Ait-Khaled M, Craig C, Alcorn...
- 11
- 255
- 0
Chromium speciation in municipal solid waste: Effects of clay amendment and composting
... there was about 20% Zn in leachable form and 77% Zn in plant available form in the blank MSW sample, but in sewage sludge only less than 1.5% Zn was in leachable and 29% Zn in plant available form ... dried at IOS’C and ground before metal extraction for determination of metal speciation Drying a sample will change the metal speciation in the sample and make the metals more available (Qiao and ... 18 G HO and L QIAO incubators The heavy metal leachability, plant availability and the total metal content in the artificial compost was determined by CaClz and DTPA extraction and acid digestion...
- 7
- 683
- 0
Measurement of Color, Gloss, and Translucency of White Salted Noodles- Effects of Water Addition and Vacuum Mixing.pdf
... vacuum mixing Vacuum mixing at –55 kPa and –90 kPa resulted in a significant increase in b* values (Table III) Variables of water addition and vacuum mixing change dough density by eliminating ... g) was mixed using a TOM pilotscale horizontal pin vacuum mixer with a maximum flour capacity of kg and a maximum vacuum capacity of –100 kPa (at the Ball Noodle factory) The main treatments applied ... were milled at 60% extraction using a laboratory-scale Buhler flour mill Wheat cultivars were Cadoux, Kulin, Nyabing, and Cranbrook Experiment Grain from ASWN and Australian Hard (AH) was milled...
- 7
- 660
- 0
Children’s Health Deficits due to Diarrhoea: Effects of Water Supply and Sanitation Systems in Slums with Different Water Logging Conditions
... defecating in latrine Hygiene practices Hand washing with soap before eating Hand washing without soap before eating No hand washing before eating Hand washing after defecation with soap Hand washing ... NCD Hand washing with soap before eating Hand washing without soap before eating No hand washing before eating Hand washing after defecation with soap Hand washing after defecation without soap ... Project in Dhaka City Japan International Cooperation Agency, Dhaka Water Supply and Sewerage Authority, Dhaka, Bangladesh Kalter H D., Gray R., Black R and Gultiano S A (1990) Validation of postmortem...
- 15
- 702
- 0
Tài liệu EFFECTS OF AIR POLLUTION FROM A NICKEL-COPPER INDUSTRIAL COMPLEX ON BOREAL FOREST VEGETATION IN THE JOINT RUSSIAN-NORWEGIAN-FINNISH BORDER AREA ppt
... laboratory for analysis During the winter the samples in all the individual collectors had to be transported to the laboratory for thawing, weighing and bulking Maintenance of to the laboratory ... vitis-idaea Betula–Vaccinium–Deschampsia Betula–Empetrum–Cladonia Pinus–Vaccinium vitis-idaea X Pinus–Vaccinium vitis-idaea Pinus–Cladonia Pinus–Vaccinium vitis-idaea Pinus–Vaccinium vitis-idaea Pinus–Cladonia ... vegetation assessments Sampling and chemical analysis of precipitation Bulk deposition was monitored on plots in Norway, Russia and Finland for a period of one year (Table 2) The plots in Norway and...
- 18
- 640
- 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... Mxi1 and outlined above (we have renamed the original Mxi1 isoform Mxi1-SRb) [12] Specifically, Mxi1-SRa can also bind to Max and to Sin3, and can function as a transcriptional repressor upon various ... expressed detectable levels of introduced Mxi1-SRa as assessed by western blotting analysis (Fig 1C, arrow: approximately 52 kDa band in lanes a1 and a2 in comparison to corresponding area in lane E1 ... earlier report describing Mxi1-SRa, this isoform appeared functionally homologous to Mxi1-SRb in that both could bind to Max and Sin3 and repress both basal and Myc-activated transcription of various...
- 11
- 586
- 0
Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx
... cyclosporin A (CsA), vinblastine, and valinomycin (and several other ´ drugs; N Nagy, K Goda, F Fenyvesi & G Szabo Jr, unpublished data) interact with Pgp in such a manner that preincubation of the ... agents, and in double Walker A and B mutants incapable of ATP binding and hydrolysis [18,35] These findings may be interpreted suggesting that changes in the UIC2 reactivity of Pgp are brought about ... best interpreted assuming that Vi trapping of Pgp also occurs in live cells Coupling of Pgp-mediated drug transport and ATP hydrolysis are generally interpreted in terms of ligandinduced ATPase activation...
- 6
- 590
- 0
Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt
... Authors Journal compilation ª 2006 FEBS S Devanathan et al Factors affecting Ab binding in lipid bilayers Formation of lipid membranes and peptide incorporation Fig Schematic diagram of a PWR apparatus ... is accomplished by evaluation of the optical parameters for the lipid layer before and after binding of peptide and subsequent aggregation, and of the layer composed of peptide (or a portion of ... FEBS 1393 Factors affecting Ab binding in lipid bilayers S Devanathan et al Fig Binding and aggregation of Ab in a DOPC ⁄ SM ⁄ cholesterol (1 : : 1) bilayer Spectra were obtained using a high-resolution...
- 14
- 532
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25