... 2.7: Hiệu quả kích kháng của oxalic acid lên tỉ lệ diện tích vết bệnh trên lá (%) ở các thời điểm 40, 50 và 60 NSKS 42 Hình 2.8: Hiệu quả kích kháng của oxalic acid lên tỉ lệ bệnh thối cổ bông ... 2.13: Hiệu quả kích kháng của oxalic acid lên tỉ lệ diện tích vết bệnh trên lá (%) ở các thời điểm 40, 50 và 60 NSKS 50 Hình 2.14: Hiệu quả kích kháng của oxalic acid lên tỉ lệ bệnh thối cổ bông ... 2001) và mô học (Huỳnh Minh Châu và ctv,2001). 6. Đặc tính oxalic acid và tác động của nó đối với cây trồng Tên hóa học: OXALIC ACID Công thửc hóa học: Thường tồn tại ở dạng ngm 2 phõn t...
Ngày tải lên: 10/04/2013, 21:05
... processes and the Kolmogorov equations 16.1 Stochastic Differential Equations Consider the stochastic differential equation: dX t= at; X t dt + t; X t dB t: (SDE) Here at; x and ... calculus and KBE Consider dX t=aXt dt + X t dB t: (5.1) Let hy be a function, and define v t; x= IE t;x hX T ; CHAPTER 16. Markov processes and the Kolmogorov equations 187 and ... Let a be a constant and =1 ,so dX t=adt+dB t: If t 0 ;x is given and we start with the initial condition X t 0 =x; 177 CHAPTER 16. Markov processes and the Kolmogorov equations 185 We...
Ngày tải lên: 18/10/2013, 03:20
Functional analysis sobolev spaces and partial differential equations
... Eigenfunctions and Spectral Decomposition 311 Comments on Chapter 9 312 10 Evolution Problems: The Heat Equation and the Wave Equation 325 10.1 The Heat Equation: Existence, Uniqueness, and Regularity ... of G. B. Folland [2], A. W. Knapp [1], and H. L. Royden [1]). I conceived a program mixing elements from two distinct “worlds”: functional analysis (FA) and partial differential equations (PDEs). ... 1). Consequently, f is continuous and f ≤ 1 r (α − f(x 0 )). Definition. Let A and B be two subsets of E. We say that the hyperplane H =[f = α] separates A and B if f(x) ≤ α ∀x ∈ A and f(x) ≥ α ∀x ∈ B. We...
Ngày tải lên: 04/02/2014, 11:10
Tài liệu Boundary Value Problems, Sixth Edition: and Partial Differential Equations pptx
... setting is a homogeneous differential equation containing a parameter λ and accompanied by homogeneous boundary conditions. Because both dif- ferential equations and boundary conditions are homogeneous, ... temperature, and the factor (1 +αT) shows how resistance increases with temperature. Simplify the differential equation algebraically to get dT dt =Ki 2 (t)(β +T), T(0) = 0, and identify β and K in ... ms, using β =0.26 and K =13. 0.2 Nonhomogeneous Linear Equations 23 Now, Eq. (11) may be used to form a particular solution of the nonhomoge- neous equation (9). We may a lso o bta in v 1 and v 2 by...
Ngày tải lên: 17/02/2014, 14:20
Tài liệu Báo cáo Y học: Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants pdf
... higher plants. MATERIALS AND METHODS Amino -acid sequences for individual plant tricarboxylic acid cycle and glyoxylate cycle enzymes and their constit- uent subunits were extracted from the databases and compared ... and hydrogeno- somes), and their heterotrophic lifestyle. Biol. Chem. 382, 1521± 1539. 104. Sandman, K., Periera, S.L. & Reeve, J.N. (1998) Diversity of prokaryotic chromosomal proteins and ... eukaryotic sequences from Caenorhabditis and Chlamydomonas and is very similar to homologues in c-proteobacterial genomes and (b) one that encodes the glyoxysomal enzymes of plants and fungi. Malate synthase...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils pot
... 5-LO products [5-hydroxyeico- satetraenoic acid (HETE), LTB 4 and 20-OH-LTB 4 ]andAA were isolated by reverse phase HPLC as described previ- ously [16] and radioactivity determined by liquid scintilla- tion ... were added to 4 vol. of ethanol and molar quantities of leukotriene and AA determined by HPLC and NICI-GC/MS, respectively. Lipids in the cell pellets were extracted and glycerolipid classes were ... AA. As CoA-IT has not been cloned and characterized, our knowledge of its interaction with PLA 2 isotypes and other transferases and its role in AA release, LTB 4 and PAF biosynthesis will remain rudimentary. While...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc
... in photoprotection (quenching and xanthophylls cycle) and in the formation of abscisic acid. Moreover, many species use them to make coloured flowers and fruits to attract pollinators and seed dispersers. ... and Psy2 genes and also provide the deduced complete amino acid sequences of the two enzymes, together with new insights into the transcriptional regulation of Psy1 and Psy2 in chloroplast- and ... sequenced and enabled the complete reconstruction of the Psy1 and Psy2 genes with the annotation of introns and exons. The GenBank acces- sion numbers of the two genes are EF534740 (Psy1) and EU021055...
Ngày tải lên: 07/03/2014, 05:20
Day one nucleic acid structure and function
... CGTGATGAACGGCTTCGAGCGATACGAGGGAGTGCGTCACTGCCGCTATGTGGACGAGTTGCA GATCGTCCAGAATGCGCCATGGACTCTGTCCGATGAATTCATCGCCGACAACAAAATCGACTT TGTGGCCCACGACGACATTCCGTATGTAACCGATGGCATGGACGACATCTATGCTCCTCTCAA GGCGCGCGGCATGTTTGTGGCCACGGAGCGCACTGAGGGTGTGTCCACCTCGGACATCGTAGC CCGGATCGTCAAGGATTACGATCTGTATGTGCGTCGTAATCTGGCCAGAGGCTATTCGGCCAA GGAACTCAATGTGTCGTTCCTGTCCGAGAAGAAGTTCCGGCTGCAGAACAA Nucleic Acid Sequence What does it encode? Nucleic Acids in Acid and Base The glycosidic bond of DNA and RNA is hydrolyzed by acids. Order of stability: dA, dG < ... 40,000 Linear double-stranded DNA M13 phage 6,400 Closed-circular single-stranded DNA MS2 phage 3,600 Linear single-stranded RNA Human 6,000,000,000 Linear double-stranded DNA Fruit fly 270,000,000 ... Closed-circular double-stranded DNA Bacillus subtilis 4,200,000 Closed-circular double-stranded DNA F plasmid 95,000 Closed-circular double-stranded DNA λ phage 48,500 Linear double-stranded DNA T7 phage...
Ngày tải lên: 13/03/2014, 16:42
readily prepared from more reactive acyl derivatives (acid chlorides and anhydrides)
... Carbonsäureester Acetylsalicylsäure 1899 wurde Aspirin zum Patent angemeldet Hemmt Prostaglandinsynthese im Körper 42 V6 Darstellung eines Polyesters V6 Darstellung eines Polyesters !" & ... Säuren Natürlich vorkommend: Als Phosphorsäurediester sind in der DNA die Nucleotide miteinander verbunden 26 5 2.1 Vorkommen 2.1 Vorkommen #$%6 786 2. Carbonsäureester Ester...
Ngày tải lên: 15/03/2014, 23:14
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... the mutual effects of pH and NaCl on the bimolecular association rate constant of O 2 rebinding and the quantum yield of BR for the a and b subunits within the liganded dimer and tetramer of hemoglobin ... for the last ligand binding step: K t ẳ K 1 K 2 K 1 ỵ K 2 5ị Here, K 1 and K 2 correspond to the afnity of O 2 bind- ing to the a and b subunits within the triliganded (monoliganded) tetramer ... chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits Sergei V. Lepeshkevich and Boris M. Dzhagarov Institute of Molecular and Atomic Physics, National...
Ngày tải lên: 16/03/2014, 14:20
Entropy and partial differential equations evans l c
... relations 1. Fluids 2. Elastic materials D. Workless dissipation IV. Elliptic and parabolic equations A. Entropy and elliptic equations 1. Definitions 2. Estimates for equilibrium entropy production a. ... examples 1. Ideal gas 2. Van der Waals fluid II. Entropy and irreversibility A. A model material 1. Definitions 2. Energy and entropy a. Working and heating b. First Law, existence of E c. Carnot cycles d. ... lower semicontinuous and proper. Furthermore the Legendre transform of L = H ∗ is H: L = H ∗ ,H= L ∗ .(2) We say H and L are dual convex functions. Now suppose for the moment that H is C 2 and is strictly...
Ngày tải lên: 17/03/2014, 14:29
Introduction to optical waveguide analysis solving maxwell's equation and the schrdinger equation kenji kawano, tsutomu kitoh
... : 2:49 Comparing the characteristic equations (2.30) and (2.32) for the TE mode and Eqs. (2.48) and (2.49) for the TM mode, one discovers that the characteristic equations for the TM mode contain ... relations, and then derives explicit expressions for the quasi-TE and quasi-TM modes. It shows formulations of E x and H y expressions for the quasi-TE (transverse electric) mode and E y and H x expressions ... the TE-mode analysis and then the TM-mode analysis. And, for 22 ANALYTICAL METHODS CONTENTS Preface = xi 1 Fundamental Equations 1 1.1 Maxwell's Equations = 1 1.2 Wave Equations = 3 1.3 Poynting...
Ngày tải lên: 17/03/2014, 14:41
Báo cáo khoa học: Amino acid biosynthesis and metabolic flux profiling of Pichia pastoris ppt
... Ministry of Science and Technology (CICYT project PPQ2001-1908), and the Academy of Finland (projects 52311 and 202409). The authors thank J. M. Cregg and C. Gancedo for useful comments, and O. Cos for ... York at Buffalo, NY, USA; 3 NMR-laboratory and Structural Biology and Biophysics Program, VTT Biotechnology, Helsinki, Finland Amino acid biosynthesis and central carbon metabolism of Pichia pastoris ... carbon-carbon scalar coupling constants are similar and the two doublets cannot be distinguished, and third, that for Tyr the two carbons d 1 and d 2 ,ande 1 and e 2 , respectively, give rise to only one 13 C...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... free a-hydroxyhaem rapidly dimerized and subsequently aggre- gated and precipitated and that reduction of ferric a-hydroxyhaem by sodium dithionite reversed this aggre- gation and consequently facilitated ... decrea- ses in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig. 4A, spectrum a). The absorption around 795 nm initially increased and then decreased during the ... P450 reductase, and produces biologically active molecules: biliverdin, CO, and iron, which display both beneficial and deleterious effects, depending on the circumstances [1,2]. Two isoforms of HO, HO-1 and...
Ngày tải lên: 23/03/2014, 21:20
harmonic analysis and partial differential equations - b. dahlberg, c. kenig
Ngày tải lên: 31/03/2014, 15:16
math. and phys. data - equations and rules of thumb - s. gibilisco
Ngày tải lên: 31/03/2014, 16:19
ordinary and partial differential equation routines in matlab - h.j. lee & w.e. schiesser
Ngày tải lên: 08/04/2014, 10:27
progress in nucleic acid research and molecular biology [vol 67] - k. moldave (ap, 2001) ww
Ngày tải lên: 05/05/2014, 16:43