Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc

Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns Giovanni Giorio, Adriana Lucia Stigliani and Caterina D’Ambrosio Metapontum Agrobios, Metaponto, Italy Fruits are the mechanism by which angiosperms dis- perse seeds and are the result of a tight co-evolution between plants and their seed dispersers [1]. Tomato (Solanum lycopersicum L.) belongs to the Solanaceae (Nightshade) family, which contains many differenti- ated taxa occurring worldwide. Its fruit type is the berry: red, fleshy and with a pulpy interior rich in seeds [2]. Among the 12 wild relatives of tomato, there is only one (Solanum pimpinellifolium B. Juss.) with a red berry and two with yellow, yellow–green or orange fruits [Solanum cheesmaniae (L. Riley) Fosberg; Sola- num galapagense S.C. Darwin and Peralta], whereas all Keywords carotenoid metabolism; chloroplast; chromoplast; fruit colour; phytoene synthase Correspondence G. Giorio, Metapontum Agrobios, SS Jonica Km 448.2, Metaponto, MT 75010, Italy Fax: +39 0835 740204 Tel: +39 0835 740276 E-mail: ggiorio@agrobios.it All authors contributed equally to this work (Received 22 October 2007, revised 27 November 2007, accepted 3 December 2007) doi:10.1111/j.1742-4658.2007.06219.x The fruit of tomato (Solanum lycopersicum L.) is a berry: red, fleshy and rich in seeds. Its colour is due to the high content of lycopene whose syn- thesis is activated by the phytoene synthase 1 (PSY1) enzyme, encoded by Psy1 which is distinct from Psy2. In the present study, we report on the genomic structures of the Psy1 and Psy2 genes and on their transcription patterns in different tomato tissues. Our results have completely clarified the structure of the Psy1 and Psy2 genes in the coding sequence region. The two genes were shown to have an highly conserved structure, with seven exons being almost identical and six introns being much more vari- able. For Psy1 and Psy2, respectively, the sequenced regions were 4527 and 3542 bp long, the coding sequences were 1239 bp and 1317 bp long, whereas the predicted protein sequences were 412 and 438 amino acids. The two proteins are almost identical in the central region, whereas most differences are present in the N-terminus and C-terminus. Quantitative real time PCR analysis showed that Psy2 transcript was present in all tested plant tissues, whereas Psy1 transcript could be detected in chromoplast- containing tissues, particularly in fruit where it activates and boosts lyco- pene accumulation. Interestingly, the organ with the highest relative content of Psy2 transcript is the petal and not the leaf. Psy1 is a Psy2 paralog derived through a gene duplication event that have involved other genes encoding rate controlling enzymes of the carotenoid pathway. Duplicate genes have been recruited to allow carotenoid synthesis in petals and fruits. However, recruitment of carotenoid metabolism for fruit pigmentation could have occurred later in the evolution, either because phytoene syn- thase gene duplication occurred later or because the fruit pigmentation pro- cess required a more sophisticated mechanism involving tight control of the transcription of other genes. Abbreviations cTP, chloroplastic transit peptide; PSY, phytoene synthase; qRT-PCR, quantitative RT-PCR. FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 527 the other species have green, yellow–green, dark green or black fruits [3,4]. During the development of tomato fruit, the shift from green to red colour is due to the degradation of chlorophylls and the accumulation of the carotenoid lycopene. Carotenoid pathways in plants have been described in great detail using genetic, biochemical and mole- cular data, mainly from Arabidopsis [5,6]. The first step in the synthesis of lycopene is the condensation of two molecules of geranylgeranyl diphosphate to form the 15-cis-isomer of phytoene. This two-step reaction is catalysed by the enzyme phytoene synthase (PSY). Following four desaturations and probably two [7] isomerization steps, the 15-cis phytoene is converted to all-trans lycopene by phyto- ene desaturase, f-carotene desaturase and carotene isomerases. At this point, the pathway is branched because the lycopene can be converted to lutein, which appears to be the end-product of the first branch, or to zeaxanthin, which can be further converted to violaxanthin. In plants, carotenoids are mainly involved in photosynthesis as accessory pigments, in photoprotection (quenching and xanthophylls cycle) and in the formation of abscisic acid. Moreover, many species use them to make coloured flowers and fruits to attract pollinators and seed dispersers. In tomato, for example, the flower has a bright yellow–orange corolla resulting from the combined effect of chromo- phores of neoxanthin, violaxanthin and lutein [8], whereas its fruit, owing to the high content of lycopene, is of a deep red colour at the end of the developmental process. However, in tomato, two active forms of PSY have been described, PSY1 and PSY2, each encoded by its own gene, Psy1 and Psy2. Although the first report on the cDNA sequence of Psy1 gene (pTOM5) in tomato (X60440) can be traced back to Ray et al. [9], the last annotation of the derived protein (P08196) still reports the presence of conflicting data. Moreover, the Psy2 cDNA sequence available in the NCBI database (L23424) is incomplete because it is devoid of the 5¢-region coding for the pro- tein amino-terminus. The correct DNA and proteic sequences of PSY1 were first reported by Bartley et al. [10], who demonstrated the correctness of the hypothe- sis of Armstrong et al. [11], which proposed that pTOM5 may encode the tomato homolog of the bifunctional red pepper PSY [12]. As for the Psy2 gene, the first report on the DNA sequence was pro- vided by Bartley and Scolnik [13]. These authors dem- onstrated that the genomic clone F (X60440), which was considered to be a PSY1 pseudogene by Ray et al. [14], was indeed the DNA sequence of the paralogous PSY1 gene coding for a PSY enzyme active in photo- synthetic tissues. In the present study, we report on the genomic structures of Psy1 and Psy2 genes and the transcrip- tion patterns of both genes in different tomato tissues. The role of carotenoids as secondary metabolites in the pigmentation of tomato flowers and fruits has been also reanalysed in the light of these results. Results Isolation of tomato Psy1 and Psy2 genes Using the sequences M8474 and L23424 reported in the NCBI database corresponding, respectively, to tomato Psy1 and Psy2 mRNAs, an extended database search- ing using blast program was conducted aiming to reconstruct the entire coding sequences of the two genes. The need for a reconstruction was based on the lack of information regarding the 5¢-region in the Psy2 DNA sequence and from the conflicting evidence avail- able in the database records of the PSY1 gene. Using the reconstructed sequences, a set of primers was designed and used to amplify the cDNAs derived from fruit or leaf RNAs of tomato cultivar Red Setter (Table 1). The Psy1 and Psy2 cDNAs were cloned in suitable vectors, sequenced and deposited in the NCBI database as EF534739 and EF534738. Combining these two mRNA sequences with those of GTOM5 (X60441) and clone F (X60440), two sets of primers were designed to amplify genomic DNA fragments corresponding to the introns of the two genes. The fragments were sequenced and enabled the complete reconstruction of the Psy1 and Psy2 genes with the annotation of introns and exons. The GenBank acces- sion numbers of the two genes are EF534740 (Psy1) and EU021055 (Psy2). However, the UTR regions for both genes were only partially reconstructed. The comparison of the two genes (Fig. 1 and Table 2) showed a strong conservation of the gene structure. The sequenced regions of the two genes were 4527 and 3542 bp long, respectively, for Psy1 and Psy2. The two genes contain at least seven exons and six introns. The data are not conclusive because the UTR regions were only partially sequenced. The cod- ing sequences were 1239 bp for Psy1 and 1317 bp for Psy2, with the latter being longer in the 5¢-region. The start codon is located in the second exon in both genes. Intron and exon numeration was changed com- pared to the original annotation of the Psy1 gene based on the GTOM5 sequence (X60441) because we discovered an additional intron upstream of the start Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al. 528 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS of the GTOM5 clone. Length of the first intron is 942 bp in Psy1 and 153 bp in Psy2. Corresponding exons in the central part of the two genes (i.e. exons 3, 4, 5 and 6) have the same length. Exons 2 and 7 have different length between the two genes because they code for the regions in which the two proteins are different. Exon 1 shows the greatest difference because it was only partially sequenced in both genes and, therefore, the start of characterization was dif- ferent in the two genes. As expected, a comparison of intron lengths between the two genes revealed great variability. Table 1. Oligonucleotide primer and probe sequences used for cloning and for transcript quantitation using qRT-PCR analysis of Psy1 and Psy2 genes. Gene Primer or probe name Primer nucleotide sequences (5¢-to3¢) GenBank accession number Amplicon (bp) Use 18SrRNA Le18SrRNA-F-118 GAAACGGCTACCACATCCAAG BH012957 61 RT-PCR Le18SrRNA-R-179 CCCCGTGTTAGGATTGGGT TaqMan-Le18s-140 AAGGCAGCAGGCGCGCAAA Psy1 Psy1F312 TGACGTCTCAAATGGGACAAGT EF534739 69 RT-PCR Psy1R381 CCTCGATGAATCAAAAAAACGG TaqManPsy1 TCATGGAATCAGTCCGGGAGGGAA Psy2 Psy2F952 AGGCAAGGCTGGAAGATATTTTT EF534738 72 RT-PCR Psy2R1024 GAAACAGTGTCGGATAAAGCTGC TaqManPsy2 ACGGGCGGCCATTTGATATGCTTG Psy1 PSY1For21 GGCCATTGTTGAAAGAGAGG EF534739 1522 Cloning PSY1Rev1522 TCATGCTTTATCTTTGAAGAGAGG Psy2 PSY2For27 TCTCTACGTGTATCAAAGGTAGTAAGG EF534738 1674 Cloning PSY2Rev1674 TGGCATTTAGAAACTTCATTCA Fig. 1. Comparison of the structures of the Psy1 and Psy2 genes. Table 2. Structure of tomato Psy1 and Psy2 genes. Gene DNA (nt) a mRNA (nt) a Protein Exon Intron Length 5¢-UTR CDS 3¢-UTR Length Integral cTP b Mature 1234567123456 Amino acids kDa Amino acids kDa Psy1 32 656 51 173 236 193 181 942 120 423 313 518 689 4527 276 1239 7 1522 412 45.32 62 38.50 Psy2 112 710 51 173 236 193 199 153 107 710 273 227 398 3542 338 1317 19 1674 438 48.18 86 38.72 a Exons 1 and 7 were only partially sequenced as well as the 5¢- and 3¢-UTRs. b Predicted by the TARGETP. G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red? FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 529 The predicted protein sequences were 412 and 438 amino acids for PSY1 and PSY2, respectively. Align- ment of the two protein sequences (Fig. 2) showed 78% residue identity (341 ⁄ 438). The central part of two proteins are similar, whereas the major differences are present in the N-terminus. In particular, both protein sequences start with the sequence MSVALLWVVSP and the PSY2 protein has two sequences of four and 19 residues that are not present in the PSY1 sequence. Moreover, the last four resi- dues, SLQR, at C-terminus of PSY1 are replaced by the sequence SPLAKT in PSY2. targetp and predo- tar software were used to predict the presence of putative N-terminal targeting sequences [15,16]. Both proteins were predicted by predotar to have a plastid target signal. Conversely, targetp predicted a chloro- plastic transit peptide (cTP) of 62 amino acids only for the PSY1 protein. In this case, a mature PSY1 in the plastids would have a predicted size of 38.5 kDa, which is agreement with previous experimental evi- dence [17]. targetp failed to predict a subcellular localization for PSY2 when the entire sequence was submitted. However, when the query sequence con- tained residues 1 to 91–95 of PSY2 protein, the soft- ware always detected a chloroplastic transit peptide of 86 amino acids. This may be due to the presence of specific motifs beyond the first 95 residues that inter- fere with the prediction. Transcription analysis in tomato tissues Psy1 and Psy2 transcript contents were estimated in RNA samples derived from root, leaf, petal, anther, ovary and fruit at three developmental stages (Mature Green, Pink and Ripe) using quantitative RT-PCR (qRT-PCR) with gene-specific fluorescent probes (Fig. 3). Since the estimates of Psy1 and Psy2 relative tran- script contents were normalized onto the 18S rRNA (endogenous reference) transcript contents and com- pared to normalised petal transcript content (calibra- tor), it is possible for each gene to make an easy comparison of the relative transcript contents among the nine tissues (Figs 4 and 5). Psy1 transcript was absent in root RNA, whereas it could be detected in leaf, sepal, ovary and in the fruit at mature green stage. However, in these tissues, Psy1 transcript con- tent ranged between 2% and 3% of the content in the petal. This organ appeared to contain a considerable amount of Psy1 transcript. As expected, Psy1 tran- script showed a typical increase between the Mature Green and Pink and a reduction between the Pink and Ripe stages. The Psy2 transcription pattern was quite unpredict- able in that the organ with the highest content was shown to be the petal instead of the leaf where the PSY2 enzyme has a pivotal role in the assembly of photosynthetic apparatus. Very similar amounts of this transcript were detected in leaf, sepal and ovary RNAs. Fruit RNAs contained Psy2 transcript at a level allowing easy detection, although it was very low compared to the content in petal RNA. By contrast to Psy1, the Pys2 transcript was detectable in root RNA. Estimates of the relative contents of the two tran- scripts for each tissue were derived with the compara- tive Ct methods. The differences between the estimates Fig. 2. Sequence alignment of PSY1 and PSY2 protein derived from analysis with CLUSTAL W program (EMBL). Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al. 530 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS A B C D MG P R Fig. 3. Organs of tomato assayed for Psy1 and Psy2 transcript content. (A) Roots. (B) Expanding leaf. (C) Flower organs: calyx (sepals), corolla (petals), stamen cone (sta- mens) and pistil (ovary, style and stigma). (D) Fruit developmental stages: MG, Mature Green; P, Pink; R, Ripe. Fig. 4. Transcription analysis of tomato Psy1 gene carried out using qRT-PCR with gene-specific fluorescent probes on transcripts from nine different tissues. At least two RNA samples were assayed for each tissue. Three replicated reactions were performed for each sample, both in the construction of standard curve and in the quanti- tation of samples. The estimates are expressed as the mean ± SD. Fig. 5. Transcription analysis of tomato Psy2 gene carried out using qRT-PCR with gene-specific fluorescent probes on transcripts from nine different tissues. For details, see Fig. 4. G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red? FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 531 of the threshold cycle means of the two genes for each tissue were used as the exponent in the formula 2 (DCt) . Accordingly, and assuming that the efficiency of the amplification of the two genes was equal, it is possible to obtain an estimate for each tissue of the transcript content of Psy1 relative to Psy2 (Fig. 6). In green tis- sues (i.e. in leaf, sepal and ovary), the content of Psy1 transcript was 0.4-fold lower than that of Psy2 tran- script. Conversely, in pigmented tissues, such as petal, anther and fruit at Pink and Ripe stages, the content of Psy1 was shown to be much greater than that of Psy2 transcript. The estimates ranged between 5.2-fold greater in the petal to 213.3-fold greater in the fruit at the Pink stage. Discussion In the present study, we report on the molecular char- acterization of the tomato Psy1 and Psy2 genes and also provide the deduced complete amino acid sequences of the two enzymes, together with new insights into the transcriptional regulation of Psy1 and Psy2 in chloroplast- and chromoplast-containing tis- sues of tomato. The results obtained have completely clarified the structure of the Psy1 and Psy2 genes in the coding sequence region. The two genes were shown to have a highly conserved structure, with seven exons being almost identical and six introns being much more vari- able in sequence and length. The two deduced protein sequences showed high similarity in the central part (86% residue identity) beyond the putative transit pep- tide cleavage site. The two putative cTPs, as predicted by targetp, showed a greater diversity, with the PSY1 having two putative deletions of 4 and 19 residues. Interestingly, the two proteins start with the sequence MSVALLWVVSP, which is the longest stretch of iden- tical residues in the N-terminus. A blast search (blastp algorithm) of the NCBI protein database using this sequence as a query resulted in the retrieval of all PSY protein sequences belonging to dicotyledons. Moreover, a search performed with the motif MSXXXXWVVXP was also able to retrieve all these proteins. With respect to chloroplastic transit peptide func- tion, the localization of PSY1 and PSY2 into the sub-compartments of plastids has not yet been com- pletely clarified, although extensive studies have been carried out in tomato [13,18,19] and in Narcissus [20–22]. The results obtained in tomato were not conclusive, probably because of a confounding effect due to the two different forms of PSY. However, as noted by Gallagher et al. [23] in grass PSYs, differ- ences in the N-terminus as well as the C-terminus of the two proteins may result in differences in their plastid localization. Transcription analysis of the two genes using qRT- PCR clearly showed that, with the exception of Psy1 in the roots, transcripts of both genes are detectable in all tested tomato tissues. Unexpectedly, the organ with the highest relative content of Psy2 transcript is the petal and not the leaf. Psy2 transcript content in the leaf is only approximately 25% of that in the petal. This result could not be anticipated because Psy2 was thought to be the chloroplast-specific PSY and no pre- vious report had addressed gene expression in this organ using a method as sufficiently sensitive as quan- titative real time PCR. The high content of Psy2 tran- script in tomato petals could also explain why the flowers of yellow flesh mutants, r and r y , are pale or normal, respectively, whereas, in the lines in which the Psy1-derived transgene triggered a cosuppression of PSY genes, the flowers were almost white [24]. In the fruit, Psy2 transcript is detectable at all tested stages and appears to increase during ripening. Finally, PSY2 must have some specific activities in the roots because Psy2 transcript is present in this tissue in con- trast to Psy1 transcript which is undetectable. Psy1 transcription analysis results were in accor- dance with those obtained in previous investigations [25,26]. Psy1 transcript is almost undetectable in the fruit from the onset of maturation until the Mature Green stage. From the Breaker stage onward, the tran- script level increases dramatically reaching its maxi- mum at the Pink stage and decreasing slowing with the progression of fruit ripening. Its content in the fruit at Pink stage is almost three-fold greater than Fig. 6. Transcript content of Psy1 relative to Psy2 across all tissues. Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al. 532 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS that in the petals. Nevertheless, Psy1 transcript content in this organ was estimated to be 5.2-fold greater than that of Psy2 which has its greatest expression in the petal. Taken together, these results confirm the specialized role of PSY1 in the colouring of fruit and that of PSY2 in the synthesis of carotenoids involved in pho- tosynthesis, in photoprotection (quenching and xan- thophylls cycle) and in the formation of abscisic acid. Both genes appear, however, to be involved in the flower colour process because their transcript contents in the petal were very high, particularly Psy2 tran- script. Psy1 is a Psy2 paralog derived through a gene dupli- cation event. After duplication, the two genes have been maintained in the genome owing to subfunction- alization, which, in this case, is in the form of a division of gene expression [27]. The recruitment of primary carotenoid metabolism as secondary metabo- lism has been described in maize [23] as well as in tomato for flower and fruit pigmentation [8]. However, in tomato, it has been hypothesised that recruitment required duplication of all genes encoding the rate- controlling enzymes of the pathway, namely carotene beta-hydroxylase, lycopene cyclase and PSY, and that the duplicated pathway was exploited originally for flower pigmentation and only later for fruit pigmenta- tion [8]. The latter hypothesis serves to explain why all 13 tomato species have yellow coloured flowers, whereas only three have red, yellow, yellow green or orange coloured fruits [4]. However, it is not known whether the recruitment of the metabolism for fruit pigmentation has occurred on a second occasion because the PSY gene ancestor duplicated later or because the subfunctionalization of the two paralogs was more complex, thus requiring more time. By comparing the protein sequences of the PSY par- alogs and that of carotene beta-hydroxylase paralogs (CrtR-b1, CAB55625; CrtR-b2, ABI23730), it is found that a reduced similarity (73.7% residue identity and 82.6% similarity) is seen for CRTR-Bs compared to PSYs (77.8% residue identity and 85.3% similarity) that could indicate an early duplication of the CrtR-b gene ancestor. However, the recruitment of PSY1 for fruit carotenoid metabolism has likely required a more sophisticated mechanism involving the tight and timely control of Psy1, Lcy-b and Lcy-e transcription during fruit development. Accumulation of lycopene in tomato fruit, and therefore the colour shift from green to red, starts at the Mature Green stage when the seeds have completed their development and are able to give rise to new plants. This mechanism can be con- sidered as a sort of light switch because the tomato fruit is switched on at the appropriate time to appear like a red light in the green background of the plant canopy, thus alerting the seed dispersers. Experimental procedures Plant materials and nucleic acid extraction Tomato plants (cv. Red Setter) were grown in a green- house. Total genomic DNA and total RNA were extracted by leaf and fruit tissue samples using standard protocols. Complementary DNA was synthesized from 1.5 lgof RNA using the ThermoScriptÔ RT-PCR System kit (Invi- trogen, Carlsbad, CA, USA) with random hexamer primers following the manufacturer’s instructions. Primer design, amplification of genomic DNA and cDNA and sequencing Using the reconstructed sequences of Psy1 and Psy2 cDNAs, a set of primers were designed and used to amplify the cDNAs synthesized from fruit or leaf RNAs of the tomato cultivar Red Setter. Amplification was performed with the kit PhusionÔ High-Fidelity DNA Polymerase (Finnzymes Oy, Espoo, Finland) in a PTC-200 thermal cycler (MJ Research, Bio- Rad Laboratories Inc., Hercules, CA, USA) in 20 lL reac- tion volume. After checking the specificity of the reactions by agarose gel electrophoresis analysis, an aliquot of the reaction was used to produce recombinant vectors with pCRÒ-BLUNT II-TOPOÒ (Invitrogen), which were trans- formed into competent Escherichia coli cells. Plasmid DNA harbouring the two genes were isolated from recombinant cells and used for sequence analysis. Sequencing reactions were performed with the ABI PRISMÒ BigDyeÒ Terminator v3.1 Cycle Sequencing kit and analysed with the Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Using specific software, the Psy1 and Psy2 partial mRNA sequences were assembled. Combining these two mRNA sequences with those of GTOM5 (X60441) and clone F (X60440), two sets of prim- ers were designed to amplify genomic DNA fragments cor- responding to the introns of the two genes. After PCR, the amplified fragments were gel purified and sequenced using the protocols reported above. Quantitative analysis of Psy1 and Psy2 transcript contents (qRT-PCR) Transcription analysis of tomato Psy1 and Psy2 genes was carried out using qRT-PCR with gene-specific fluorescent probes. Transcript contents were estimated in RNA sam- ples derived from root, leaf, petal, anther, ovary and fruit G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red? FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 533 at three developmental stages (Mature Green, Pink and Ripe). Reactions were conducted in 96-well reaction plates in a 25 lL volume containing 12.5 lL of the PlatinumÒ Quanti- tative PCR SuperMix-UDG (Invitrogen), 300 nm forward primer, 300 nm reverse primer and 150 nm TaqMan probe. One microlitre of the cDNA sample (75 ng of RNA) was used for each reaction. qRT-PCR was performed using the iCycler iQÔ Real Time PCR Detection System (Bio-Rad Laboratories Inc.). Thermal cycling condition were 95 °C for 3 min for activation of DNA polymerase, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Estimates of tran- script content were derived using the standard curve method [28] performing reactions in separate tubes. Stan- dard curves were prepared for both the target transcripts, Psy1 and Psy2, and the endogenous reference 18S rRNA gene using a petal cDNA stock sample, by assembling a set of reactions using three-fold serial dilutions with six points for 18S rRNA and eight points for both Psy1 and Psy2. Each PCR reaction was performed in triplicate, both for the construction of the standard curves and for sample quantitations. Gene starting quantities for each sample were estimated using regression parameter estimates of the standard curve. Estimates of Psy1 and Psy2 relative tran- script contents were normalized onto the endogenous refer- ence transcript (18S rRNA) to account for differences in the amount of total RNA content among samples and com- pared with the normalised transcript content of petal, which was chosen as calibrator. Sequences of primers and Taq- ManÒ probes were the same as those previously used [25] and are reported in Table 1. Acknowledgements We wish to thank all colleagues of Metapontum Ag- robios who collaborated in the project. We are grateful to Professor Peter Beyer (Freiburg, Germany) for valu- able comments and helpful suggestions and Professor Gerhard Sandmann (Frankfurt, Germany) for critical reading of the manuscript. References 1 Knapp S (2002) Tobacco to tomatoes: a phylogenetic perspective on fruit diversity in the Solanaceae. J Exp Bot 53, 2001–2022. 2 Knapp S, Bohs L, Nee M & Spooner DM (2004) Solan- aceae – a model for linking genomics with biodiversity. Comp Funct Genomics 5, 285–291. 3 Peralta IE, Knapp S & Spooner DM (2006) Nomencla- ture for wild and cultivated tomatoes. Rep Tomato Genet Coop 56, 6–12. 4 Peralta IE & Spooner DM (2007) History, origin and early cultivation of tomato (Solanaceae). In Genetic Improvement of Solanaceous Crops, Vol. 2: Tomato (Razdan MK & Mattoo AK, eds), pp. 1–27. Science Publishers, Enfield, CT. 5 DellaPenna D & Pogson BJ (2006) Vitamin synthesis in plants: tocopherols and carotenoids. Annu Rev Plant Biol 57, 711–738. 6 Sandmann G, Ro ¨ mer S & Fraser PD (2006) Under- standing carotenoid metabolism as a necessity for genetic engineering of crop plants. Metab Eng 8, 291–302. 7 Li F, Murillo C & Wurtzel ET (2007) Maize Y9 encodes a product essential for 15-cis-f-carotene isomer- ization. Plant Physiol 144, 1181–1189. 8 Galpaz N, Ronen G, Khalfa Z, Zamir D & Hirschberg J (2006) A chromoplast-specific carotenoid biosynthesis pathway is revealed by cloning of the tomato white- flower locus. Plant Cell 18, 1947–1960. 9 Ray J, Bird C, Maunders M, Grierson D & Schuch W (1987) Sequence of pTOM5, a ripening related cDNA from tomato. Nucleic Acids Res 15, 10587. 10 Bartley GE, Viitanen PV, Bacot KO & Scolnik PA (1992) A tomato gene expressed during fruit ripening encodes an enzyme of the carotenoid biosynthesis path- way. J Biol Chem 267, 5036–5039. 11 Armstrong GA, Alberti M & Hearst JE (1990) Con- served enzymes mediate the early reactions of caroten- oid biosynthesis in nonphotosynthetic and photosynthetic prokaryotes. Proc Natl Acad Sci USA 87, 9975–9979. 12 Dogbo O, Laferriere A, d’Harlingue A & Camara B (1988) Carotenoid biosynthesis: isolation and character- ization of a bifunctional enzyme catalyzing the synthesis of phytoene. Proc Natl Acad Sci USA 85, 7054–7058. 13 Bartley GE & Scolnik PA (1993) cDNA cloning, expres- sion during development, and genome mapping of PSY2, a second tomato gene encoding phytoene syn- thase. J Biol Chem 268 , 25718–25721. 14 Ray J, Moureau P, Bird C, Bird A, Grierson D, Maun- ders M, Truesdale M, Bramley P & Schuch W (1992) Cloning and characterization of a gene involved in phy- toene synthesis from tomato. Plant Mol Biol 19, 401– 404. 15 Emanuelsson O, Brunak S, von Heijne G & Nielsen H (2007) Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc 2, 953–971. 16 Small I, Peeters N, Legeai F & Lurin C (2004) Predo- tar: a tool for rapidly screening proteomes for N-termi- nal targeting sequences. Proteomics 4, 1581–1590. 17 Fraser PD, Truesdale MR, Bird CR, Schuch W & Bramley PM (1994) Carotenoid biosynthesis during tomato fruit development (evidence for tissue-specific gene expression). Plant Physiol 105, 405–413. 18 Fraser PD, Kiano J, Truesdale M, Schuch W & Bram- ley PM (1999) Phytoene synthase-2 enzyme activity in Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al. 534 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS tomato does not contribute to carotenoid synthesis in ripening fruit. Plant Mol Biol 40, 687–698. 19 Fraser PD, Schuch W & Bramley PM (2000) Phytoene synthase from tomato (Lycopersicon esculentum) chlo- roplasts – partial purification and biochemical proper- ties. Planta 211, 361–369. 20 Kreuz K, Beyer P & Kleinig H (1982) The site of carotenogenic enzymes in chromoplasts from Narcissus pseudonarcissus L. Planta 154, 66–69. 21 Schledz M, Al-Babili S, Lintig JV, Haubruck H, Rab- bani S, Kleinig H & Beyer P (1996) Phytoene synthase from Narcissus pseudonarcissus: functional expression, galactolipid requirement, topological distribution in chromoplasts and induction during flowering. Plant J 10, 781–792. 22 Bonk M, Hoffmann B, Lintig J, Schledz M, Al-Babili S, Hobeika E, Kleinig H & Beyer P (1997) Chloro- plast import of four carotenoid biosynthetic enzymes in vitro reveals differential fates prior to membrane binding and oligomeric assembly. Eur J Biochem 247, 942–950. 23 Gallagher CE, Matthews PD, Li F & Wurtzel ET (2004) Gene duplication in the carotenoid biosynthetic pathway preceded evolution of the grasses. Plant Physiol 135, 1776–1783. 24 Fray RG & Grierson D (1993) Identification and genetic analysis of normal and mutant phytoene syn- thase genes of tomato by sequencing, complementation and co-suppression. Plant Mol Biol 22, 589–602. 25 Giorio G, Stigliani AL & D’Ambrosio C (2007) Agro- nomic performance and transcriptional analysis of carotenoid biosynthesis in fruits of transgenic HighCaro and control tomato lines under field conditions. Trans- genic Res 16, 15–28. 26 Giuliano G, Bartley GE & Scolnik PA (1993) Regula- tion of carotenoid biosynthesis during tomato develop- ment. Plant Cell 5, 379–387. 27 Zhang J (2003) Evolution by gene duplication: an update. Trends Ecol Evol 18, 292–298. 28 ABI PRISM 7700 Sequence Detection System (2001) Relative Quantitation of Gene Expression. User Bulletin #2. AB Applied Biosystems, Foster City, CA. G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red? FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 535 . Phytoene synthase genes in tomato (Solanum lycopersicum L. ) – new data on the structures, the deduced amino acid sequences and the expression patterns Giovanni. for Psy2, with the latter being longer in the 5¢-region. The start codon is located in the second exon in both genes. Intron and exon numeration was changed