off this rule is disapplied in a scheme
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx
... angles are equal and the ratio of the corresponding sides is in proportion Parallelograms A parallelogram is a quadrilateral with two pairs of parallel sides B A C D In this figure, AB ʈ ෆD and BC ... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and ... line has a slope of and a vertical line does not have a slope at all—it is undefined Parallel lines have equal slopes Perpendicular lines have slopes that are negative reciprocals Data Analysis Review...
- 25
- 410
- 0
Charles Darwin: His Life in an1Charles Darwin: His Life in anAutobiographical Chapter, and in a Selected Series of His Published Letters, by Charles Darwin, Edited by Sir Francis Darwin This eBook is for the use of anyone anywhere at no cost and with potx
... discovery of the singular relations of the animals and plants inhabiting the several islands of the Galapagos archipelago, and of all of them to the inhabitants of South America As far as I can ... stiff a book it is, this is a large sale It has been translated into almost every European tongue, even into such languages as Spanish, Bohemian, Polish, and Russian It has also, according to Miss ... messing by ourselves in the same cabin We had several quarrels; for instance, early in the voyage at Bahia, in Brazil, he defended and praised slavery, which I abominated, and told me that he had...
- 245
- 605
- 0
Báo cáo hóa học: " Markedly impaired bilateral coordination of gait in post-stroke patients: Is this deficit distinct from asymmetry? A cohort study" ppt
... further away from reflect increasingly impaired bilateral coordination Impairments in gait asymmetry and bilateral coordination of gait in stroke patients The gait of the stroke patients is characterized ... ideal 180° line All this results in about a fold higher PCI value for this stroke patient This example is consistent with the group findings; the average PCI was about times larger in the patients, ... this rhythmical task [27] Imbalance in motor pathway integrity might lead to this instability [28] The gait of healthy young adults who intentionally slow down is characterized by increased intra-...
- 8
- 333
- 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12] At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands ... study and manuscript revision JK was involved in the design and statistical analysis of the study MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript ... this journal on the utility of daily routine CXRs in clinical decision making in the ICU In that study, a questionnaire was completed for each radiograph, addressing the indication for the radiograph...
- 7
- 722
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
- 137
- 853
- 0
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi
... deal with approaches in teaching writing skill 2.1 Approaches in Teaching Writing Nowadays, the teaching of writing has long been a central element in all educational system and there are many, ... significant improvement in various areas of linguistic knowledge taught in the program Next study is a paper documents an initiative in introducing a genre-based approach to EFL teaching in the Japanese ... Approach According to Lin (2002: 18), the teaching and learning around text genres has become increasingly influential in mainstream ELT in countries However, their influence in EFL in East Asian...
- 31
- 560
- 2
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells ... that this evidence establishes that the goods are related The first article indicates that skin toner, cologne and skin cream contain vitamins The second article contains recipes for skin care ... registration are unrelated to those listed in the application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board instituted the appeal...
- 8
- 416
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse...
- 14
- 635
- 0
Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx
... peptide mixture, as obtained by cyanogen bromide and a- amylase treatment, is shown in Fig 3A As revealed by MALDITOF analysis, several eluate fractions contained an 11-mer peptide having the sequence ... i.e a mass of 28 Da y-Type fragments are C-terminal [28] Probably due to a loss of NH3 from asparagine, many fragments show a satellite peak at )17 Da Fragments bearing a glucosyl moiety are marked ... change, the level of a relatively small maltodextrin is increased more than threefold that, as judged from HPAEC, has a DP of approximately It is remarkable that the size of this maltodextrin is...
- 12
- 513
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI restriction site that ... (440 kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences ... Kawakami et al FAD, FMN and ATP-containing amino-acid dehydrogenase (dye-l-proDH) [3,4], and found these enzymes to be highly stable and to exhibit a high potential for application in amino-acid...
- 11
- 549
- 0
Báo cáo khoa học: A novel prokaryotic L-arginine:glycine amidinotransferase is involved in cylindrospermopsin biosynthesis potx
... DNA Isolation Kit (MoBio, Carlsbad, CA, USA), according to the manufacturer’s instructions PCR amplification of cyrA was performed using primers cyrA-F (5¢-CATATGCAAACAGAATTGTAAATAGCT3¢) and cyrA-R ... replaced by the smaller amino acids alanine and threonine This results in a much larger active site than in AGAT, and allows for binding of inosamine phosphate, the substrate of StrB1 [31] CyrA ... l-Alanine, b-alanine, c-aminobutyric acid, ethanolamine, taurine, l-lysine, a- amino-oxyacetic acid and l-norvaline were used as amidino group acceptors The limit of detection for the assays was...
- 17
- 544
- 0
Off the Rim Basketball and Other Religions in a Carolina Childhood docx
... Willie Mays, say, and Carl Furillo for Hank Aaron, and Karl Spooner for Vinegar Bend Mizell—and came up with a team of players all born in Alabama When I was nine years old my family had taken a trip ... to last After a slump in the early 1950s, Carolina hired as head coach an alumnus, Jim Tatum, who had just won a national championship at Maryland, and Tatum was going to take the Heels all the ... a random tick bite, Carolina might have been a football school—and Dean Smith a math teacher back in Kansas From what I have written you might think that my father was also an athlete and a sports...
- 260
- 492
- 0
Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot
... concludes Semantic analysis as classification This section describes an abstract architecture which characterises semantic analysis as a task slightly extending the "decision-list" classification algorithm ... not a great deal of training data available, and the statistical methods used are simple and unsophisticated However, we still get a significant improvement on rules alone by adding a trainable ... pattern((Pattern), (Atom), (Example)) where (Pattern) is a pattern, (Atom) is an atom it predicts, and (Example) is an example of an utterance that should contains this pattern Continuing the example, a possible...
- 8
- 461
- 0
Báo cáo khoa học: "A Comparison of Rule-Invocation Strategies in Context-Free Chart Parsing" pot
... recursion worse than Earley's algorithm, illustrates this: Assume a grammar with rules S * Ae, A * aA, A -* b and a sentence aa a a a b c" to be parsed Here a bottom-up parser such as Kilbury's ... University, LinkSping, Sweden Pereira, Fernando C N and David H D Warren (1980) Definite Clause Grammars for Language Analysis A Survey of the Formalism and a Comparison with Augmented Transition ... used in these experiments have been obtained from Masaru Tomita and can be found in his book (Tomita 1986) Grammars I and II are toy grammars consisting of and 43 rules, respectively Grammar III...
- 8
- 355
- 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
... π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equation GRAPHICAL OFF THE AXIS 29 x3 -axis One half rotation Figure 2: The helicoid is ... think of an axis for such a disk Σ as a point or curve away from which the surface locally (in an extrinsic ball) has more than one component With this weak notion of an axis, our estimate is ... multi-valued graph if it is not a graph We can therefore apply Part II to get almost flatness of a corresponding stable disk past the slab This is needed when the minimal surface is not in a thin slab...
- 43
- 410
- 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia ... several post-translational modifications; while in the ER it is glycosylated at a single N-linked site at amino acid 533 that is further matured in the Golgi increasing the molecular mass of secreted...
- 14
- 454
- 0
Does This Make Me Look Fat? Aesthetic Labor and Fat Talk as Emotional Labor in a Women''''s Plus-Size Clothing Store potx
... that term, insisting (accurately) that what has been called ‘plus-size’ is in fact average,” (p xxxi) Indeed, as described above, Real Style’s in- store, television, and catalogue marketing campaigns ... small or flat In one case, a Latina customer was having trouble finding a pair of jeans with a good fit, when Gia, a plus-sized Latina sales associate, gently suggested that the customer try a ... Conditions Does This Make Me Look Fat? so long as this does not clearly discriminate against protected categories (Avery and Crain 2007; see also Rhode 2010); workplace discrimination on the basis of “style”...
- 21
- 515
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25