nmr studies of quality factors in processed cereal products
Báo cáo khoa học: P NMR studies of energy metabolism in xanthosine5¢-monophosphate overproducing Corynebacterium ammoniagenes pot
... growing medium were optimized to gain maximum XMP production (Table 1) As shown in Table 1, an increase in the glu/glc ratio (glu/glc) induced a significant increase in XMP production, and this increase ... switch in the carbon flux In Table 1, glu increased the XMP/Hyp ratio, being dependent on the increased level of glu/glc ratio up to 0.46, which mainly resulted from the extension of the length of ... in XMP production was coupled with a reduction in production of the by-product, hypoxanthine XMP production attained nearly plateau levels at a glu/glc molar ratio of 0.31 Further increases in...
- 5
- 304
- 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... canonical binding site on nPS is identical to that 702 observed in the case of the M tuberculosis protein [11] In fact, the residues of nPS involved in binding pantoate are highly conserved in the ... molecule in the ATP-binding site (Fig 8) Binding of pantoate and ATP to nPS The crystal structure of nPS has shown clearly the bound form of pantoate in the ATP-binding site The enzymology of substrate ... substrate binding (Fig 2) His106 in E coli PS, which is located at the end of the insertion sequence in A thaliana PS, is also unaffected by substrate binding His106 is involved in intersubunit interactions...
- 16
- 791
- 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
... factors including Ets, GATA, and MyoD/E-box binding factors The introduction of mutation into one of the putative Etsbinding sequences suppressed the promoter activity In addition, the specific binding ... aberrant expression of a3b1 integrin in tumor cells and their malignant behavior The increased expression of a3b1 integrin in gastric carcinoma cells is associated with their increased invasion and ... deficient in this integrin receptor die during the neonatal period with kidney and lung defects and skin blistering [11] Additional abnormalities in the morphogenesis of limbs were observed in integrin...
- 9
- 562
- 0
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
... synthesis of proteins in the presence of other proteins provided in excess at the start of or during the reaction, e.g., for the purpose of rescuing nascently produced insoluble proteins into soluble ... system for NMR studies of protein–protein interactions J Biomol NMR 32, 235–241 Kainosho M & Tsuji T (1982) Assignment of the three methionyl carbon resonances in Streptomyces subtilisin inhibitor ... encountered in the case of the C-terminal domain of the s subunit of DNA polymerase III from E coli, a 16 kDa a-helical protein [10] Combinatorial [15N]-labelling depends on suppression of transamination...
- 6
- 461
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... strong change, of )0.07 p.p.m., relative to H1 of ring C in CST0606 For all of the other ring E signals in both hexasaccharides the movements are marginal The remaining two pairs of residues may ... be cleaved more often, resulting in a predominance of 4-sulfated GalNAc residues at the reducing terminus of the resulting oligosaccharides This significantly reduces the number of oligosaccharides ... pairs of increments were sampled into 1024 complex points using a mixing time of 70 ms The array was zero-filled to 2048 · 2048 complex points and transformed in each dimension after application of...
- 11
- 481
- 0
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... form In this conformation, the avin uorescence is strongly quenched by the binding of 3-aminopyridine adenine dinucleotide [14] The FAD of thioredoxin reductase is readily replaced by other avins ... and 15N -NMR studies on proteinbound and free avins [17], the data referring to free avins are also given in Tables and for comparison In the latter studies, the avin was either dissolved in water ... that of FMN but at slightly higher eld than that of protein-bound FAD in wild-type enzyme As shown by model studies, polarization of the isoalloxazine ring of avin through hydrogen bonding at...
- 16
- 378
- 0
Báo cáo khoa học: Alternative initiation of transcription of the humanpresenilin 1gene in SH-SY5Y and SK-N-SH cells The role of Ets factors in the regulation ofpresenilin 1 pptx
... recognize specifically Ets motifs flanking the +1 site (A) The binding of nuclear factors is eliminated by mutations in Ets motifs The binding of nuclear factors present in SK-N-SH (K) or SH-SY5Y (H) ... contains two DNA binding inhibitory domains flanking the Ets domain: the central 87 amino acid inhibitory domain is poorly conserved and virtually specific to ERM, and the C-terminal domain that ... Ets factors and factors binding at adjacent sites, as well as cofactors that not bind DNA themselves [29,30] Hence the specific set of factors present in a given cellular context probably determines...
- 10
- 492
- 0
Aptitude for Destruction, Volume 2 - Case Studies of Organizational Learning in Five Terrorist Groups pptx
... sustained changes that involve intentional action by or within a group at some point—such as one or more of the following: intentional seeking of new knowledge or new ways or doing things; intentional ... clothes to indicate their levels of religious attainment Members could rise through the ranks of the organization by paying initiation fees to participate in certain levels of training To join the ... commercially and another informal in the form of repeated experimentation The few instances of formal training focused on specialized expertise in how to operate things The informal training focused on...
- 216
- 307
- 0
Báo cáo khoa học: High-resolution NMR studies of the zinc-binding site of the Alzheimer’s amyloid b-peptide pdf
... upon zinc addition, indicating that the aromatic ring of Tyr10 is not involved in binding of the metal Instead, the e and d resonances of the histidines show significant intensity losses, of > ... the involvement of these residues in metal coordination In particular, the specific changes in the Asp1 chemical shift provide a direct indication of the involvement of the N-terminus in zinc binding ... and can be interpreted in the same terms as specific binding of the metal in the N-terminal part of the peptide These observations confirm that the zinc-binding site is in the N-terminus, and are...
- 14
- 355
- 0
Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx
... value of viscosity increased with increasing concentrations of 1alkanols and decreased with increasing temperature As the number of hydrocarbon groups or the chain-length of the alcohol increased, ... that in the case of liquid systems, including electrolytic solutions, there is no serious harm in assuming cubic packing and equating b to 3.3 Gibb’s Free Energy (ΔG*) On the basis of Eyring rate ... variation in excess free volume as a function of the concentration of 1-alkanols in all systems The values of excess free volume were almost positive in all of the systems and decreased with increasing...
- 13
- 258
- 0
Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf
... original authors (mainly urine protein excretion, serum creatinine or creatinine clearance, or a combination of these) and subsequent relapse Adverse events sought included mortality, infection (especially ... residual bias in observational studies and lack of blinding in randomised trials The amount of information for MMF is greater than for cyclophosphamide and azathioprine in this indication, and ... evaluation of homogeneity tests in meta-analyses in pain using simulations of individual patient data Pain 2000, 85:415-424 33 L'Abbe KA, Detsky AS, O'Rourke K: Meta-analysis in clinical research Ann Intern...
- 10
- 433
- 0
báo cáo khoa học: " TILLING for allergen reduction and improvement of quality traits in peanut (Arachis hypogaea L.)" pdf
... difference being an in- frame insertion of 36 bp in Ara h 2.02, resulting in an insertion of 12 amino acids containing an extra copy of the sequence DPYSPS, a known allergenic IgE-binding epitope ... http://www.biomedcentral.com/1471-2229/11/81 Page of 13 Figure IgE binding analysis of seed protein extracts from M4 generation of Ara h 2.01 mutant lines 20-6 and 37-4 A - Equal amount of total protein from seeds of wild type (Georgia ... included 25 amino acid signal peptide, are cleaved off during posttranslational processing The 53 or 59 amino acid cleaved peptides contain six of the seven cysteines found in Ara h isoforms [40]...
- 13
- 330
- 0
Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx
... volumes Those investigators showed that, after RMs, PEEP set at cmH2O above the lower inflection point was more effective in maintaining gas exchange and minimizing inflammation and lung injury than ... lower inflection point before a sustained inflation Loop B: tidal insuflation with a PEEP below the lower inflection point after a sustained inflation Loop C: PEEP higher than the lower inflection ... severely injures lungs does not lead to release of significant amounts of inflammatory cytokines by the lung in the absence of lipopolysaccharide challenge Likewise, in experimental studies other investigators...
- 7
- 287
- 0
Báo cáo y học: " The role of angiogenic factors in predicting clinical outcome in severe bacterial infection in Malawian children" doc
... maintenance of vessel integrity Angiopoietin-1 (Ang-1) and Ang-2 are ligands of the endothelial receptor tyrosine kinase Tie-2, which is a key regulator of endothelial function [14] Binding of circulating ... understanding of factors controlling endothelial integrity, and our results are consistent with those of previous studies [19,22,26,28] Although the number of controls in our study was small, the inclusion ... outcome in children with severe bacterial infection, the association being independent of confounding factors in the case of Ang-1 High Ang-2 concentrations are associated with mortality In bacterial...
- 11
- 280
- 0
influence of some factors in western culture on english learners’ communication in vietnam
... English, I assume that the age of interlocutors in the most important factor in selecting linguistic forms of greeting in Vietnam II.2.3 In Making Requests Requesting form in Vietnamese and English ... communicating culture between Vietnam and Western countries .17 II.2.1 In Giving and Accepting Compliment Behaviors 18 II.2.2 In Greeting 19 II.2.3 In Making Requests . 22 II.2.4 In Giving invitation ... states that one of the most common types of indirect speech act in English has the form of an interrogative This is true to inviting In fact, this is a great difference between inviting English and...
- 55
- 400
- 0
An Analysis of Cultural Factors in the Textbook English 12 from the Perspective of English as an International Language = Phân tích các yếu tố văn hóa trong sác
... one of the goals of using culture in EIL teaching is to help individuals interact in crosscultural encounters, then merely knowing about a culture will not be sufficient to gain insight into ... evolving way of life of a group of persons, consisting of a shared set of practices associated with a shared set of products, based upon a shared set of perspectives on the world, and set within ... teaching and learning of English has been influenced by Inner Circle countries The influence is vastly expressed in training programs making English nearly impossible to be "a neutral medium unlinked...
- 66
- 1,099
- 8
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS
... Determination of salt gland density in A officinalis leaves 67 Figure 3.4: Salt gland structure from A officinalis leaves 69 Figure 3.5: Estimation of ions in xylem sap of A officinalis ... Quantification of hormones in leaves of two-month-old A officinalis seedlings up on salt treatment 77 Figure 3.9: Quantification of hormones in roots of two-month-old A officinalis seedlings ... CCATTAGGTGGCCAGCTCTC 24 Annotation Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers...
- 218
- 765
- 0
Ion channeling studies of defect formation in gan and related materials
... surprising success After this, interest in GaN research grew rapidly as clear in Fig 1.1 and interest is being maintained due to essential position of GaN and its alloys in solid state lighting ... backscattering similar to surface increasing χmin The dechannelling factor σD in case of stacking fault is given by, σD = χmin (4.18) Additional monolayer Figure 4.4: A schematic of a stacking fault ... materials in making devices introduces defects The control of these defects is very important Ion channelling can be used to look into the introduction and removal of defects during materials processing...
- 124
- 442
- 0
Analysis of transcription factors in living human cells with the help of split ubiquitin system
... Box is the binding site for the TATA-binding protein (TBP) In some genes, the transcription initiation site consists of the initiator element (Inr) defined as an element encompassing the transcription ... system for screening of interacting partners inside human cells using the linker histone as a bait protein This novel interaction screening method could potentially be used with any of the numerous ... ~40 The final packaging ratio is determined by the folding of the 30nm particles upon themselves to give an overall packaging ratio of ~1,000 in euchromatin and 10,000 for heterochromatin in mitotic...
- 124
- 346
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25