nguyễn thị mai lan
New Biotechnologies for Increased Energy Security : The Future of Fuel
... stover xylan extracted using DMSO and a commercial oat spelt xylan (Fluka) extracted under alkaline conditions The commercial xylan has no signal for the acetate ester present in the DMSO xylans ... components: cellulose, hemicellulose and lignin Xylan, a prevalent plant cell wall polymer made up of mostly xylose, is of particular interest as the dominant plant cell wall hemicellulose (Ebringerová ... enzymatic removal of xylan, it is useful to develop antibodies capable of tagging xylan in biomass Antibodies can be tagged with fluorescent dyes, allowing the location of the xylan in biomass to...
- 335
- 403
- 0
Báo cáo hóa học: " Self-Assembled Polymeric Micellar Nanoparticles as Nanocarriers for Poorly Soluble Anticancer Drug Ethaselen" pdf
... where mPEG-PLA micelles maintained their stability after drug loading only for several hours or days It was attributed to the lost of a hydrophilic and hydrophobic balance, which was the critical ... exposed to alternating 12-h periods of light and darkness Temperature and relative humidity were maintained at 25 °C and 50%, respectively All care and handling of animals were performed with the ... resulting copolymers were dissolved in CDCl3, and 1HNMR spectra were taken at 300 MHz with trimethylsilane (TMS) as internal reference standard using a Bruker MSL2300 spectrometer (Bruker, Germany)...
- 10
- 300
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... removal activity 10 activated sludge samples were collected from waste water treatment plant in Tokyo These plants were configured as aerobic, anaerobic–aerobic or anaerobic–anoxic–aerobic modes ... GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT Reference Lane (1991) Lane (1991) This study This study Crocetti et al (2000) Crocetti et al (2000) Crocetti et ... Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Most eubacteria Planctomycetales Verrucomicrobiales Sequence (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG...
- 7
- 719
- 0
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... pasture land'; closes a geographical account of Lebanon thus, 'There are in Libanus and Antilibanus themselves fertile and well-tilled valleys, rich in pasture land, vineyards, gardens, plantations ... Alps no longer remained terra incognita to dwellers far and near We have accounts of Alpine journeys by the Abbộ Majolus v Clugny (970), Bernard v Hildesheim (1101), Aribert v Mailand, Anno v Coeln[5], ... the sea, and Wat of Sturmland, standing upon the hill, blew a great blast on his horn, which was heard in the land for miles round The sound of Wat's horn wakened a young maid, who, stealing on...
- 194
- 633
- 0
the development of an instrument to measure individual dispositions towards rules and principles; with implications for financial regulation
... design as the main method for this project, introducing Dworkin’s position on rules and principles which forms the conceptual basis of this project, outlining the main content of the remaining nine ... explanation of the meaning / definitions of the concepts of rules and principles as used in the thesis Section 1.8 outlines the chapter contents of the whole thesis Section 1.9 identifies the main ... type on the CFO's tendency to carry the debt off balance-sheet With a principles-oriented auditor, the CFO's tendency to take the debt off balance-sheet is lower when GAAP is also principles-based...
- 379
- 303
- 0
Development of a flexible forcing immersed boundary lattice boltzmann method and its applications in thermal and particulate flows
... Computational domain with (a) body fitted and (b) non-body fitted Cartesian mesh Fig 2.1 D2Q9 lattice model with respective lattice velocity directions 33 Fig 2.2 A two dimensional domain ... (b) particle-1 89 Fig 4.1 A two dimensional domain Ω containing a heated immersed boundary Γ 101 Fig 4.2 Computational domain for Natural convection process from a hot circular ... axissymmetric flow past the sphere at Re = 250 on (a) XZ and (b) XY plane 170 Fig 6.5 Schematic diagram of the computational domain (100×160×100 mm3) followed for the single sphere sedimentation...
- 266
- 644
- 0
Development of a miniature low cost UAV helicopter autopilot platform and formation flight control of UAV teams 1
... or backwards, i.e., pitch motion Lateral plane is a plane parallel to the YABC − ZABC plane Longitudinal plane is a plane parallel to the XABC − ZABC plane 1.4 Goals and Objectives The goal of ... of the main and tail rotor Lift thrust is then varied by increasing or decreasing the collective pitch The main rotor is powered by a DC motor The Collective pitch is the pitch of the main rotor ... frame Collective pitch angle of main blade Collective pitch angle of tail blade Yawing angle in NED frame Stabilizer bar rotor time constant Main rotor time constant Main rotor rotating speed governed...
- 89
- 301
- 0
Development of a miniature low cost UAV helicopter autopilot platform and formation flight control of UAV teams 2
... the main rotor dynamics is described by two coupled first-order equations which represent the lateral and longitudinal flapping motions of the assumed tip-path-plane Physically, the tippath-plane ... relative to hub plane, and β0 is the coning angle of the rotating rotor Compared with the full-scale counterpart, the main difference residing in the smallscale helicopters is that the main rotor is ... sequentially implemented a variety of model derivation methods, including: time-domain system identification and frequency-domain system identification [11] These two methods are for linear model identification...
- 93
- 323
- 0
Development of bioresorbable polycaprolactone composite mesh for antimicrobial control release and haemostatic properties
... (hemorrhage) and infections Hemorrhages during implantations and in wounds occur rather frequently It was also previously reported that uncontrolled hemorrhage remains the leading cause of pre-hospital ... risks [Ragel and Vallet-Regi 2000] Specifically in orthopaedic implant applications, 22% of revision operations arose due to implant infection [Achneck et al 2009], with consequent increased healthcare ... [Lawson et al 2005, Schoenecker et al 2001] Fibrin sealants were have also been explored and used in patients [Rousou et al 1989] Fibrin sealant systems consist of both thrombin and fibrinogen...
- 163
- 345
- 0
Development of high contrast coherent anti stokes raman scattering (CARS) and multiphoton microscopy for label free biomolecular imaging
... stability of PCF-based supercontinuum light source is still remained to be a challenge Due to the existence of the nonresonant background mainly from the two-photon resonant transition, the CARS spectrum ... EP-CARS = Elliptically polarized CARS F-CARS = Forward-detected CARS FDTD = Finite-difference time-domain FWHM = Full width at half maximum fs = Femtosecond HP-CARS = Heterodyne polarization CARS IP-CARS ... background (v) The use of near-infrared (NIR) wavelength excitation minimizes the photodamage (mainly water absorption) to the sample and also provides a large penetration depth for thick samples...
- 145
- 840
- 0
Development of optical phase evaluation techniques application to fringe projection and digital speckle measurement
... Unwrapped results guided by pseudo-correlation map 104 Fig 5.32 (a) Plane-fitting quality map; (b) Unwrapped results guided by plane-fitting map 105 Fig 5.33 (a) Sinusoidal signal with high frequency ... reference speckle field B j Kx,y −1 Slope criterion of a plane xi LIST OF SYMBOLS l Distance from the exit pupil of imaging optics to the reference plane m, n Variables M, N Constant Mor Morlet wavelet ... method was explored in an increasing number of applications such as the measurement of in-plane, out-of-plane deformation, slope, curvature, and topographic contouring Furthermore, the development...
- 153
- 493
- 0
Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx
... protiated solvents The desalting step mainly removes deuterium exchanged for labile hydrogens, i.e hydrogen attached to N, O and S in the side chains, and not main chain amide hydrogens at acidic ... is evidenced by the progressive loss of spectral spreading and the simultaneous growth of some main envelope at the typical frequencies of unfolded polypeptides (around p.p.m.) The format- V37 ... samples) were analyzed by CE performed at constant current of 80 lA, with the capillary cooling fluid maintained at 278 K Samples also contained 0.2 mgÆmL)1 of a marker peptide Shown are the summed...
- 14
- 358
- 0
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc
... 3.1.1 Formation and main services 43 3.1.2 Vision 43 3.1.3 Strong business results 44 3.2 Businesses 46 3.2.1 Enterprise Resource Planning (ERP) service ... the America passed the job of making covered wagon and clipper ships' sails to workers in Scotland; England's textile industry flourished in the 1830s as that work was outsourced to Indian manufacturers ... often annoyed by instability For example, the 2006 coup in Thailand, the Kashmir conflicts between Pakistan and India, and the Sri Lankan military’s struggles against the Liberation tigers of Tamil...
- 79
- 611
- 6
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... cause an off‐flavor to develop in shrimp. ‐ A2.2: Wetland. A wetland also can be a solution to Quang Tri Province. The wetland is located near the shrimp ponds and consists of soil with a certain slope and obstacles in it, ... constructed wetland depend on the size of the wetland needed, which on itself depends on the amount of flowing wastewater. The advantages of the constructed wetlands are that ... Phosphates and BOD are mainly caused by feeding the shrimps more than they can eat and giving them too many antibiotics. The excess of these substances will remain in the water ...
- 13
- 487
- 0
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc
... them were maintained in RPMI-1640 media supplemented with 10% fetal bovine serum which contained 100 units/ml of penicillin and 100 units/ml of streptomycin All cells were routinely maintained ... anti-tumor activity in the tumor-bearing nude mice from 21 to 31 days after implantation with OSRC-2 cells On day 31 post-implantation, the mean tumor volume was 678.70 ± 121.73 mm3 in FA-PEAs: pVHL-treated ... ml serum-free medium for incubation h Then the complete medium 1640 was added, and the plate was maintained at 37°C for 24 h to observe green fluorescence expression under Fluorescence Inverted...
- 10
- 453
- 0
Báo cáo sinh học: " Raman enhancement of rhodamine adsorbed on Ag nanoparticles self-assembled into nanowire-like arrays" docx
... Greece *Corresponding author: yraptis@central.ntua.gr Email addresses: MP: mr.panagopoulou@gmail.com NP: nickpantiskos@yahoo.gr PP: pmphotopoulos@gmail.com JT: tangjun@nuc.edu.cn DT: dtsouk@imel.demokritos.gr ... Phys Rev B 2001, 64:235402 [7] Tao A, Kim F, Hess C, Goldberger J, He R, Sun Y, Xia Y, Yang P: Langmuir-Blodgett silver nanowire monolayers for molecular sensing using surface-enhanced Raman...
- 22
- 386
- 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
... sharing in networked VEs is to have most of the main data-set replicated across all the sites and transmit only incremental changes Furthermore the main data-set is often cached locally at each ... sec maximum), subjective difficulty rating (difficulty in maintaining the Romberg stance, 1–10 scale), and dispersion of center-of-balance Postural stability was found to vary as a function of ... systems use cameras to track the person and then transform this information to the 6-DOF needed to maintain a proper image in the VE (Motion Analysis, Inc) So far we have confined our discussion...
- 10
- 449
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25