nef202 203gg virus infected pig tailed macaques showed reduced cytokine secretion and expression of activation markers on cd3 t cells
Báo cáo y học: " Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear impo" doc
... cellular context, we next demonstrated that co -expression of HIC and Rev in COS7 cells resulted in the cytoplasmic sequestration of Rev with a concomitant reduction in its nuclear accumulation and this ... reported that the ectopic expression of HIC resulted in the mislocalisation of HIV-1 Tat to the cytoplasm This contrasted with an earlier report which showed that Tat and HIC co-localised in the ... Musashimurayama, Tokyo, Japan 18 19 20 Authors’ contributions LG conducted experimental procedures, data interpretation, and contributed to the experimental design and to drafting the manuscript TT contributed...
- 13
- 282
- 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt
... indicated The incorporation of radioactive dNMP was measured by acid-precipitation of DNA and scintillation counting The total radioactivity was measured after spotting lL of a 200-fold dilution of ... established that the species specificity of lytic infection by the polyomaviruses SV40 and PyV is determined at the level of DNA replication both in vivo and in vitro by the nature of the host ... thymus Determination of the polypeptide responsible for primase activity J Biol Chem 263, 8981–8988 44 Matsumoto, T. , Eki, T & Hurwitz, J (1990) Studies on the initiation and elongation reactions...
- 8
- 326
- 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt
... are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo III, 5¢-GTTTTTATCCGATGCAAATTTTTGCTTTGT GATTG-3¢ The reaction was performed in 20 ... purification of the protein the association of the protein kinase and its substrate was not affected even though stringent conditions were used It is possible therefore, that these two proteins ... which in turn interacts directly with DNA Of the several strategies that modulate the binding of a protein with its target DNA, to effect transcription, phosphorylation is regarded as one of the major...
- 12
- 365
- 0
Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx
... GGGGGCTAGCGCGTGGTCGTGATAGTCAGCATGTACGCTG GTGCGTCCTTTATACCAGCCTCCCTT GGGGGCTAGCGCGTGGTCGTAAAAGCAACTAGAAATAGC GGGGGACGTGCGTCGGTATGCGCTTAGCCTTAG GGGGGCTAGCGCGTGGTCGAGGGGACCTTGCAAGTCCCC GGGGGACGTGCGTCCTTTGTACCGACCTCCGCC AATTGCGGCCGCCCGCAAGCTGGCGCGCGTAGTCGTTGGCCACGTCTAGACGGGGCACGTCGACGAAATCAATT ... GACGCACGTCGCAAATGATTATGCCAGGCAATTGGCCGCCGGGTGGGGGCCTTGCGAGGTTCTTCT GGGGTCTAGACGGGGGGTGCAAAAGTTATCAGGCATGCAC GGGGGACGTGTTGCCGGGCGAGTACTCCAAAACTAATC GGGGTCTAGACGGGGGGTGCGATAGTCAGCATGTACGCTG GTGTTGCCGGGCCTTTATACCAGCCTCCCTT GGGGTCTAGACGGGGGGTGTAAAAGCAACTAGAAATAGC ... GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAA CAGCAGAATGGTTTCACG CAGAAGCTCATCCGGCTG AGCATCACGACGCCGTCA GCTGTTCTCAGCCTCACT...
- 12
- 334
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... production, suggesting that the action target of both TA and TN is the same as that of a -T It is very interesting that a -T and TS showed opposite effects on PKC in this study, although the structures ... These studies suggest that the inhibitory effect of a -T was due to reduction of accelerated PKC activity with TS in VSMC TA and TN also showed the inhibition effect like aT on TS-activated NO ... compared the effects of a -T and its derivatives TA and TN with that of TS on LPS/IFN-induced NO production The additions of a -T, TA and TN did not induce NO production in the absence of LPS/IFN,...
- 6
- 494
- 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
... common to stress-activating PERK, PKR or HRI It also suggests that the effect of Nck on the phosphorylation of eIF2aSer51 is independent of the type of stress condition mediating the activation of ... inhibition of general translation with the concomitant promotion of the translation of specific mRNAs This is well illustrated by the increased translation of the activating transcription factor (ATF4), ... direct interaction with the b-subunit of eIF2 [19] In addition, we have reported that increased cellular levels of Nck strongly impair the phosphorylation of eIF2aSer51, attenuation of translation...
- 11
- 376
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... substitution of Met53 enabled modulation of activity and kinetic parameters for maltodextrins Introduction of a bulky aromatic group misguided the substrate glycon part to loose interaction with ... (Figs and 5; Table 4) In the case of Met53Trp this amounted to 15% of the total products, compared to Ê 3% and Ê 1% for Met53Tyr and Met53Ala AMY1, respectively It is noted that action patterns at ... loop showed that modication at subsite )2 could importantly inuence utilization of the outermost subsite-6 Such long-range interactions in the substrate-mutant enzyme complex between subsite )2 and...
- 14
- 557
- 0
Báo cáo hóa học: " Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols" docx
... to the final step, defuzzification The input of the aggregation process is the list of truncated output functions returned by the implication process for each rule The output of the aggregation ... explains the working of the general fuzzy system Fuzzification of inputs and outputs The first step is to take the inputs and determine the degree to which they belong to each of the appropriate fuzzy ... with different degrees of mobility and routing protocols show that the composition of packets in the queue determines the effect of giving priority to control packets or setting priorities among...
- 11
- 362
- 0
The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf
... Operation of Multiplication The Operation of Division The Operation of Subtraction Fractions Decimals Powers and Roots Ratios and Proportions Practical Applications of Arithmetic Percentage Interest ... operation had to be done very often, and so another great short cut was made in the operation of addition and mental calculation took another step forward But multiplication was not only a mere matter ... the extraction of roots is the inverse of multiplication but it is a much more difficult operation to perform than that of involution Ratios and Proportions.—Ratio is the relation which one number...
- 95
- 383
- 0
Ultrasonography in In Vitro FertilizationRoger A. PiersonDepartment of Obstetrics, Gynecology pptx
... amplitude and frequency of contractions are hypothesized to facilitate blastocyst implantation (126) The effects of progesterone on uterine contractions have been demonstrated by the observation that ... endometrial receptivity and the probability of implantation with the exception of a strong negative correlation when the endometrium is thin (81,83,84) It is also possible that inconsistencies in the ... administration on uterine contractility at the time of embryo transfer Fertil Steril 2001; 75:1136–1140 124 Baruffi R, et al Effects of vaginal progesterone administration starting on the day of oocyte...
- 26
- 178
- 0
Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot
... data support an independence of the HRS in regard to ER- or p53/p21 -expression Effects of the combination of irradiation and hormone incubation In combination with irradiation both tested hormones ... Because of mutation of p53 in PC-3 cells, we could not detect any expression of p21 in this cell line [31] (plots not shown) and after incubation with low concentration of genistein or estradiol ... actin in LNCaP after 24 h of hormonal incubation, irradiation with 0.5 Gy and Gy h after irradiation the cells were harvested and subjected to protein extraction The shown results represent one...
- 12
- 368
- 0
Báo cáo y học: "Discovering and validating unknown phosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools" doc
... solution An aliquot of this solution (20 μl) was incubated with the peptide solution in a total volume of 40 μl of washing/loading solution for 30 with constant rotating After incubation, the ... lost when the neutral loss ions are isolated for MS3 Multistage activation (or pseudo MS3) allowed us to get spectra that were the combination of MS/MS and MS3 fragmentation and thus retaining the ... and positions of the Ca trace of the solute were constrained with a force constant of 500 kcal mol-1rad-2 to impede a spurious disorganization of the structure during the heating of the system During...
- 16
- 265
- 0
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
... ØN contributed to the design of the study, interpreted data and revised the manuscript UM interpreted the data and revised the manuscript MT interpreted data and revised the manuscript TT conceived ... addition, it shows the selection and accumulation of virus mutants that have lost the transgene or its expression Shape and size of virions The shape and size of negatively stained purified virions ... multiplication compared to the transgene positive progenitor virus strain, and that the host cell type may affect the stability of the transgene or its phenotype Methods Cells, viruses, and antibodies...
- 13
- 377
- 0
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
... ØN contributed to the design of the study, interpreted data and revised the manuscript UM interpreted the data and revised the manuscript MT interpreted data and revised the manuscript TT conceived ... addition, it shows the selection and accumulation of virus mutants that have lost the transgene or its expression Shape and size of virions The shape and size of negatively stained purified virions ... multiplication compared to the transgene positive progenitor virus strain, and that the host cell type may affect the stability of the transgene or its phenotype Methods Cells, viruses, and antibodies...
- 13
- 294
- 0
Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx
... responsible for the development of the quantification software, and assisted in data collection and manuscript preparation ARW assisted in data collection, manuscript preparation and contributed ... order to obtain a comparable level of bronchoconstriction The precise mechanisms whereby the epithelium or mucosa might regulate the expression of the intrinsic heterogeneity to luminal activation ... 11:9 http://respiratory-research.com/content/11/1/9 important in this respect by regulating airway constrictor responses and the distribution of airway narrowing throughout the lung In this study...
- 12
- 297
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... in-depth understanding of the brand personality and values; • A picture of the brand anatomy, and how its attributes are contributing to its overall position; • The same information for competitors ... identity and brand positioning according its actual market potential and future vision of its business On the basis of this, it can construct an effective communication program to its target audiences, ... 2.5.4 The identity structure Brand identity consists of a core identity and an extended identity In addition, the identity elements are organized into enduring patterns of meaning, often around the...
- 67
- 974
- 0
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx
... notion in the public’s appreciation of artistic creativity – despite Duchamp’s Fountain being considered one of the most influential artworks of the 20th century – we shall show that the notion of ... better able to appreciate these merits The artist’s insight is to recognize the transformational power of this non-obvious context switch Perhaps the most famous (and notorious) readymade in the ... The Jigsaw Bard The cognitive / linguistic intuitions that underpin the Bard’s concept of textual readymades are put to the empirical test in section While readymades remain a contentious notion...
- 6
- 442
- 0
Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx
... artifacts in that their existence is not an interpretation of a past event but instead a witness to it However, within the sphere of material culture studies, it is generally accepted that the ... manifestation of Satan, which he fought publicly Sunday played on the latent fears of a nation in transition, a transition that simultaneously offered both hope and exploitation for millions of foreign ... admits the verity of an intersection between the material and spiritual worlds There exists a consensus of written documentation, both in Sunday’s own writings and in the first- and secondhand...
- 169
- 398
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... feature of all the proposed mechanisms is the initiation of catalysis with the deprotonated form of the amine substrate, and it is widely accepted that it is the deprotonated form of the substrate that ... concentration of the neutral amine species We not propose that it is only the protonated form that initially binds, but rather that preferential binding of the deprotonated form to the active site ... leads to a shift in the equilibrium of the substrate ionization The present study emphasizes the benefits of using deuteration of compounds in conjunction with standard stopped-flow and steady-state...
- 9
- 327
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25