Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes Tonje Fiskaa 1, *, Eirik W. Lundblad 1,2, *, Jørn R. Henriksen 1,3 , Steinar D. Johansen 1 and Christer Einvik 1,3 1 Department of Molecular Biotechnology, RNA Research group, Institute of Medical Biology, University of Tromsø, Norway 2 Department of Microbiology, University Hospital of North Norway, Tromsø, Norway 3 Department of Pediatrics, University Hospital of North Norway, Tromsø, Norway Group I ribozymes, which normally perform intron splicing reactions within the nucleus of many unicellu- lar eukaryotes, can be modified to trans-splice 3¢ exons into separate RNA molecules in a sequence- specific reaction. Group I intron trans-splicing is initiated by the binding of an exogenous guanosine (exoG) into the ribozyme guanosine-binding site. Sub- sequently, base pairing between the internal guide sequence (IGS) at the 5¢ end of the ribozyme and a target RNA sequence creates a pseudo-P1 structure containing the 5¢-splice site, which becomes attacked by the bound exoG. The splicing reaction proceeds through two consecutive transesterification steps. When targeting mutated messenger RNAs, trans-spli- cing may lead to chimerical reprogrammed transcripts of biochemical or therapeutic interest. Despite the fact that more than 2000 group I introns are known by sequence [1], only a few have been applied in RNA reprogramming approaches. The Tetrahymena ribozyme has been used in almost all reported cases of RNA reprogramming (including RNA repair) [2– 7], except for a few studies using the Pneumocystis ribozyme [8,9] and the Didymium myxomycete ribo- zyme DiGIR2 [10,11]. Keywords a-mannosidase mRNA; group I intron; RNA repair; RNA reprogramming; trans-splicing Correspondence S. D. Johansen, Department of Molecular Biotechnology, RNA Research Group, Institute of Medical Biology, University of Tromsø, N-9037 Tromsø, Norway Fax: +47 776 45350 Tel: +47 776 45367 E-mail: Steinar.Johansen@fagmed.uit.no *These authors contributed equally to this study (Received 17 March 2006, accepted 27 April 2006) doi:10.1111/j.1742-4658.2006.05295.x Trans-splicing group I ribozymes have been introduced in order to mediate RNA reprogramming (including RNA repair) of therapeutically relevant RNA transcripts. Efficient RNA reprogramming depends on the appropri- ate efficiency of the reaction, and several attempts, including optimization of target recognition and ribozyme catalysis, have been performed. In most studies, the Tetrahymena group IC1 ribozyme has been applied. Here we investigate the potential of group IC1 and group IE intron ribozymes, derived from the myxomycetes Didymium and Fuligo, in addition to the Tetrahymena ribozyme, for RNA reprogramming of a mutated a-mannosi- dase mRNA sequence. Randomized internal guide sequences were intro- duced for all four ribozymes and used to select accessible sites within isolated mutant a-mannosidase mRNA from mammalian COS-7 cells. Two accessible sites common to all the group I ribozymes were identified and fur- ther investigated in RNA reprogramming by trans-splicing analyses. All the myxomycete ribozymes performed the trans-splicing reaction with high fidelity, resulting in the conversion of mutated a-mannosidase RNA into wild-type sequence. RNA protection analysis revealed that the myxomycete ribozymes perform trans-splicing at approximately similar efficiencies as the Tetrahymena ribozyme. Interestingly, the relative efficiency among the ribozymes tested correlates with structural features of the P4–P6-folding domain, consistent with the fact that efficient folding is essential for group I intron trans-splicing. Abbreviations exoG, exogenous guanosine; IGS, internal guide sequence; RPA, RNA protection analysis. FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2789 RNA reprogramming in cell cultures based on the Tetrahymena ribozyme remains inefficient in spite of significant efforts to increase the specificity and effi- ciency [6]. Several attempts to improve the reaction have been performed, including extending the IGS at the 5¢ end of the ribozyme to enhance target recogni- tion [4,12,13], adding a P10 helix to promote the sec- ond step of trans-splicing [12] and removing competing side reactions to increase the accuracy [10]. We aim to introduce new natural group I ribozymes in optimiza- tion and application studies of the trans-splicing reac- tion, and recently reported RNA reprogramming of a mutated glycosylasparaginase mRNA sequence by a Didymium myxomycete group IE ribozyme deficient in hydrolysis [10]. Both the specificity and the efficiency of trans-splicing were improved by extending the IGS and by the removal of unwanted hydrolysis side reac- tions by ribozyme modifications. Here we report the mapping of accessible ribozyme target sites in a mutant version of a-mannosidase mRNA isolated from mammalian COS-7 cells. A strategy based on random- ized IGS [3,11], using four distinct group I ribozymes, the Didymium group IE ribozyme (named DiGIR2), two Fuligo group IC1 ribozymes (named Fse.L569 and Fse.L1898), and the prototype Tetrahymena group IC1 ribozyme (Tth.L1925), were used. Two accessible sites, common to all four ribozymes, were identified and included in site-directed RNA reprogramming. Results and Discussion Structural features of the myxomycete group IC1 and group IE ribozymes The intron secondary-structure diagrams presented in Fig. 1A show that all four ribozymes included in this study have an overall similar structural organization of the catalytic domain (P3–P7–P8). The different myx- omycete ribozymes were selected as a result of their pronounced in vitro splicing activities and because of their distinct structural features [14,15]. Whereas DiGIR2, derived from the twin-ribozyme intron Dir.S956-1 in D. iridis [14,16–18] represents the group IE ribozymes, the two F. septica ribozymes, Fse.L569 and Fse.L1898, represent group IC1 ribozymes [15]. Finally, the prototype T. thermophila group IC1 ribo- zyme, Tth.L1925, was included as a reference control. A dramatic variation in both sequential and struc- tural features is noted among the folding domains pre- sented in Fig. 1B (P4–P6). This domain varies in size from only 94 nucleotides in DiGIR2 to 681 nucleotides in Fse.L569, with the intermediate-sized Tth.L1925 and Fse.L1898 folding domains (157 nucleotides and 198 nucleotides, respectively) in between. The P4–P6 domain has an essential role in initiating the RNA-folding process, leading to the functional 3D architecture of a group I ribozyme [19–21], and the high-resolution structure of the Tetrahymena ribozyme domain [22,23] identified both intradomain (A–bul- ge ⁄ P4 interaction, and L5b–P6 tetraloop receptor interaction) and interdomain (P14 pseudoknot base- pairing) tertiary interactions. DiGIR2 has a less complex structure without any obvious intradomain interactions and only one assigned (but apparently weak) L9b–P5 interdomain interaction [14], features typical of the IE subclass of nuclear group I ribo- zymes. Fse.L569, on the other hand, harbours a group IC1 folding domain with branched P5 (P5abc) and the A-bulge in P5a. Large extensions are located in P5b and P6, as well as in the highly unusual P5d region. The latter region is more than 300 nucleotides long and contains 17 identical copies of a 16-nucleotide tan- dem repeat motif [15]. The repeat has probably no important function in splicing as a mutant ribozyme with only seven copies performs the self-splicing reac- tion at similar rates, and cognate self-splicing intron ribozymes in Badhamia and Diderma (Bgr.L569 and Dni.L569, respectively) lack the repeat (S. D. Johansen et al., unpublished results). Group IC1 and group IE ribozymes select the same accessible sites in an a-mannosidase mRNA sequence Deficiency of lysosomal activity of human a-mannosi- dase, an exoglycosidase enzyme involved in the ordered degradation of N-linked oligosaccharides, results in the autosomal-recessive lysosomal storage disorder, a-mannosidosis [24]. The most frequent mutation in a-mannosidase is the R750W substitution, and affected individuals accumulate partially degraded oligosaccharides in the lysosome [25]. No causal treat- ments are currently available for a-mannosidosis, and there is thus a need for developing alternative gene therapy approaches. Group I ribozyme-based mRNA repair may represent an interesting new approach in gene therapy by reprogramming RNA molecules carry- ing disorder mutations. To investigate whether RNA reprogramming could be applied on human a-mannos- idase mRNA, total RNA isolated from COS-7 cells expressing R750W mutant a-mannosidase was mixed with ribozyme libraries designed to detect accessible target sites within the messenger RNA. GN 4 ⁄ 5 ribo- zyme-tag libraries (see Experimental procedures) were constructed for each of the group I ribozymes (Fig. 1A). During incubation at trans-splicing condi- RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al. 2790 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS tions, a unique 3¢ exon tag (Fig. 1A) was trans-spliced into various mRNA sequences, based on the accessibil- ity to the ribozymes [11]. The resulting RNA recombi- nants were detected and identified by an RT-PCR approach, cloned into plasmid and subsequently DNA sequenced. Here, a total number of 19 distinct clones, all representing true trans-splicing events within an  1 kb region of the mRNA, were identified. This region was chosen because it contains sequences upstream of the R750W substitution (Fig. 1C) and is thus suitable for RNA reprogramming by group I ribozyme trans-splicing. Surprisingly, only three access- ible sites were detected (Fig. 1C). Whereas the Tetra- hymena ribozyme detected all three sites (U1357, U1381, and U1732), the Fuligo and Didymium ribo- zymes detected the same two sites (U1357, U1381). Several interesting findings are noted from this experi- ment, namely that (a) sites U1357 and U1381 appear to be particularly accessible because they were detected by all four ribozymes, (b) U1357, U1381 and U1732 could not be predicted as unambiguous accessible regions by the mfold computer program (data not shown), stressing the importance of determining accessible sites within target RNAs experimentally, (c) no obvious sequence similarities were seen between the selected target sites and the natural 5¢ splice sites of the ribozymes, indicating that the accessible site detection was based on true selection, (d) two of the selected target sites (U1357 and U1732) were identical in sequence, but the latter was only detected by the Tetrahymena ribozyme, and (e) the selected target sequences GCACCU(1357 ⁄ 1732) and ACGACU1381 generate GC-rich P1 pairings, suggesting that increased stability between ribozyme and target RNA is an addi- tional selective factor [26]. In summary, we found that group IC1 and group IE ribozyme-tag libraries are able to select the same accessible sites within an endog- enously expressed human a-mannosidase mRNA. Increasing the trans-splicing specificity at a-mannosidase RNA sites U1357 and U1381 The two accessible a-mannosidase RNA sites (U1357 and U1381) were selected for more detailed analysis in RNA reprogramming because they were recognized by all four ribozymes tested. In order to obtain more opti- mal ribozyme targeting, several modifications in the ri- bozyme structures were performed. These include IGSs complementary to the sequences flanking U1357 and U1381, as well as EGSs,  35 nucleotides in length, complementary to the target RNA sequences 3¢ of U1357 and U1381 (Fig. 2A). These modifications, along with the short P10 base pairing important in the second step of trans-splicing, were included to increase the spe- cificity of the reaction according to previously published work on RNA trans-splicing optimizations [4,5,10–12]. Furthermore, full-length a-mannosidase mRNA sequences ( 1660 nucleotides), corresponding to the regions 3¢ of U1357 and U1381, were added as trans- splicing 3¢ exons in the ribozyme constructs. It is important to note that these 3¢ exons harbour the RNA sequence corresponding to the wild-type arginine resi- due at position 750 (R750), and thus have to be consid- ered as restorative 3¢ exon sequences (Fig. 2B). Finally, to avoid strong intermolecular base pairing between the EGS and the restorative 3¢ exon during the trans-spli- cing reaction [10,11], the corrected (wild-type) a-man- nosidase sequences were degenerated by alternative codons for the first 16 and 15 triplets following the tar- get sites U1357 and U1381, respectively (Fig. 2A). All eight ribozyme constructs (DiGIR2, Fse.L569, Fse.L1898, and Tth.L1925 targeting both U1357 and U1381) were incubated at trans-splicing conditions (see Experimental procedures) with in vitro-transcribed a-mannosidase target RNA in a 2 : 1 (ribozyme ⁄ tar- get) molar ratio. In an RT-PCR approach, the trans- ligated exon products were amplified as the expected 390 bp and 437 bp products for positions U1357 and U1381, respectively (Fig. 3A). Representative ampli- cons for all eight reactions were DNA sequenced and confirmed to result from a correct and accurate trans- splicing reaction (Fig. 3B). A minor RT-PCR product, shorter in size than the expected 390 bp, was observed at U1357 for all four ribozyme reactions (Fig. 3A). However, after gel purification and DNA sequencing, this product was found to be a result of oligonucleo- tide mispriming during the RT-PCR reaction. In sum- mary, all four ribozymes were designed to target the two most accessible sites in a-mannosidase mRNA. Several modifications that increase the specificity and efficiency of the reaction were included, and all the ribozymes were found to perform the trans-splicing reaction in a highly accurate manner. Determination of trans-splicing efficiencies at a-mannosidase RNA sites U1357 and U1381 To determine the efficiency of the trans-splicing reac- tions and to compare the different ribozyme con- structs, the same reactions described above were performed but analysed by different experimental approaches. In the first experiment, unlabelled tran- scripts of each of the eight ribozymes and [ 35 S]CTP- labelled target RNA were mixed (2 : 1 molar ratio), incubated at trans-splicing conditions at various time points (0, 5. 15, 30, 60 and 90 min), subjected to T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequences FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2791 polyacrylamide gel analysis, and finally visualized by autoradiography. A representative time course trans- splicing analysis at U1381 is presented in Fig. 3C. Here, trans-spliced RNA (RNA1) is found to accumu- late. RNA1 from all eight reactions was gel purified and DNA sequenced by an RT-PCR approach, which confirmed that all the ribozyme transcripts were able to trans-splice target RNA in vitro in both sites (data not shown). We note that free 5¢ exons (RNA3), but not free 3¢ exons, are readily detected in the gel analysis (see Fig. 3C), an observation explained by the strong intermolecular base pairings between the exchanged 3¢ exons and EGS. Interestingly, one of the ribozymes (Fse.L1898) was apparently more effi- cient in trans-splicing at both sites compared with the other myxomycete ribozymes tested. In the second experiment we performed an RNA protection analysis (RPA) on the trans-spliced prod- ucts detected above in order to quantify the reactions and compare the efficiencies among DiGIR2, Fse.L569, Fse.L1898 and the Tetrahymena ribozyme, Tth.L1925. The RPA probes were designed to hybrid- ize to 351 and 385 nucleotides of target RNA 5¢ exon sequences, and 36 and 52 nucleotides of restorative 3¢ Fig. 1. Group I ribozymes and mutant a-mannosidase target RNA. (A) Secondary structure diagrams of trans-splicing ribozymes in accessible site selection. The paired segments P2–P9 and P13 are indicated. The randomized internal guide sequence regions (IGS; GN 5 in Tth.L1925 and DiGIR2, and GN 4 in Fse.L569 and Fse.L1898) are boxed at the 5¢ end of the ribozymes. The DiGIR2 splicing ribozyme is derived from the twin-ribozyme intron Dir.S956-1 [16]. The unique TAG sequence used in RT-PCR detection is indicated at the 3¢ end of the ribozymes. (B) Secondary structure diagrams of P4–P6 folding domains of the group I ribozymes Tth.L1925, DiGIR2, Fse.L569 and Fse.L1898. The DiGIR2 splicing ribozyme is derived from the twin-ribozyme intron Dir.S956-1 [16]. Intradomain tertiary interactions (A–bulge ⁄ P4 interactions and L5b–P6 tetraloop receptor interactions) are indicated by arrows. The 16-nucleotide direct-repeat motif present in 17 identical copies at P5d in Fse.L569 is boxed. (C) Schematic presentation of the a-mannosi- dase cDNA expressed in COS-7 cells. The selected accessible sites are indicated as T1357, T1381, and T1732. The gene mutant corresponding to the R750W substitution resulting in a-mannosidosis is shown. RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al. 2792 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS exon sequences at sites U1357 and U1381, respectively. The protected regions for the trans-spliced RNAs cor- respond to 387 nucleotides and 437 nucleotides. Gel analysis of RPA products (Fig. 4A) confirmed the above experiments of in vitro trans-splicing. The relat- ive efficiencies of the trans-splicing reactions were cal- culated in comparison to the Tetrahymena reference ribozyme, and the corresponding values are shown in Fig. 4B. Here, the average amounts of trans-spliced RNAs in four parallel experiments performed by Fig. 1. (Continued). T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequences FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2793 Fig. 2. Design of trans-splicing ribozyme constructs targeting specific sites within mutant a-mannosidase RNA sequences. (A) Design of trans-splicing ribozyme (Rz) constructs targeting a -mannosidase U1357 and U1381. The ribozyme contains an internal guide sequence (IGS) and an extended guide sequence (EGS), which base pair to the complementary sequence in a-mannosidase mRNA upstream of the R750W (C to T at position 2248) mutation. The ribozyme constructs used contain silent mutations (underlined) introduced by alternative codons in the restorative 3¢ exon. (B) Schematic presentation of the group I ribozyme-mediated trans-splicing reaction resulting in RNA reprogramming of a-mannosidase mRNA. The trans-splicing ribozyme construct base pairs to mRNA sequences upstream of the mutation (Mut) and cata- lyses the coupled cleavage of mutated mRNA and the ligation of a restorative 3¢ exon containing wild-type sequences. RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al. 2794 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS DiGIR2, Fse.L569, and Fse.L1898 are 81%, 79% and 104% for U1357, and 39%, 58% and 96% for U1381, respectively. The fact that Fse.L1898 is noted as the most efficient of the myxomycete ribozymes tested correlates well with the gel analysis presented in Fig. 3C. The efficiency of the trans-splicing ribozymes at both U1357 and U1381 target sites (Fig. 4C) appears to correlate to a putative folding problem of the P4–P6 domain, either as a result of the lack of intradomain stabilization or by misfolding of the com- plex sequence features. Fse.L1898 possesses a P4–P6 folding domain similar to that of the Tetrahymana ribozyme (Fig. 1B), both in size, organization, and pre- dicted intra- and interdomain interactions. Consistent with the above argument, we suggest that RNA fold- ing advantages in the P4–P6 domain make Fse.L1898 the most efficient of the myxomycete trans-splicing ribozymes tested (Fig. 4C). In summary, our analyses confirmed that all three myxomycete ribozymes tested perform the trans-spli- cing reaction as accurately as the Tetrahymena ribo- zyme. Furthermore, one of the ribozymes (Fse.L1898) was more efficient in trans-splicing than the other myxomycete ribozymes tested. Experimental procedures Mapping accessible sites within a-mannosidase mRNA Mapping of accessible sites in a-mannosidase mRNA by GN 4 ⁄ 5 ribozyme-tags was performed as previously des- cribed [3,11]. The IGS, preceding the UG wobble pair in Fig. 3. Reprogramming a-mannosidase RNA by group I ribozyme trans-splicing. (A) RT-PCR products from in vitro trans-splicing experiments with mutant target a-mannosidase RNA and the trans-splicing ribozymes. The RT-PCR products correspond to trans-spliced RNAs of the expected sizes (390 bp and 437 bp) at positions U1357 and U1381, respectively. The controls (Ctrl) con- tain first-strand synthesis master mix with Tth.L1925 only, or target RNA only. (B) Representative results of correct trans-spliced a-man- nosidase mRNA sequences at positions U1357 and U1381 obtained from RT-PCR amplifications. (C) Representative time-course analy- sis of in vitro trans-splicing experiments. a-Mannosidase RNA and trans-splicing ribozymes targeting U1381 were in vitro transcribed with and without [ 35 S]CTP labelling, respectively. Trans-splicing ribozymes and target RNA were incubated at a 2 : 1 molar ratio, at 50 °C for 3 h under splicing conditions. Samples were collected at 0, 5, 15, 30, 60 and 90 min. Trans-splicing products were analyzed by PAGE and visualized by autoradiography. The major RNA spe- cies detected were trans-spliced RNA (RNA1), a-mannosidase tar- get RNA (RNA2) and free 5¢ exon target RNA (RNA3). M, RNA size marker. T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequences FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2795 Fig. 4. Ribonuclease protection analyses (RPA) of trans-spliced a-mannosidase RNA sequences. (A) Schematic presentation of the RPA experimental approach. See the legends to Fig. 2B for details. (B) Represen- tative results of the major RNA species (numbered 1–4) detected in RPA. RNA1, undigested probe; RNA2, trans-spliced a-mannosidase mRNA; RNA3, a-mannosi- dase target RNA; RNA4, ribozyme RNA. M, RNA size marker. (C) Quantification of the RPA of trans-spliced a-mannosidase mRNA generated by the different trans-splicing ribozymes. Comparative quantitative data were collected from six independent RPA experiments. The trans-splicing efficiency (percentage) was calculated as previously described [10], except that values were normalized in respect to the Tth.L1925 ribozyme activity (100%). The raw yields of trans-spliced target RNA for the Tetrahymena ribozyme were found to vary from 3 to 15% and from 2 to 8% for the sites U1357 and U1381, respectively, in six independent experiments. However, the relative yields among the four ribozymes are similar for each of the experiments. RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al. 2796 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS the P1 helix (see Fig. 1), was used in GN 4 ⁄ 5 mapping libraries (n ¼ 4orn ¼ 5; G is the invariant guanosine resi- due engaged in the UG wobble pair). The libraries were PCR amplified using the primer combinations designed for each ribozyme, including OP757 ⁄ OP483 for Tth.L1925, OP758 ⁄ OP479 for DiGIR2, OP759 ⁄ OP761 for Fse.L569, and OP760 ⁄ OP762 for Fse.L1898 (Table 1). A human lyso- somal a-mannosidase cDNA, cloned into the pcDNA3.1(–) vector (Invitrogen, Oslo, Norway) under the control of the cytomegalovirus (CMV) promoter, was transfected into COS-7 cells and total RNA isolated after 24 h by the Trizol reagent (Invitrogen). Total RNA (1 lg) was mixed with low-salt buffer (40 mm Tris ⁄ HCl pH 7.5, 200 mm KCl, 2mm spermidine, 5 mm dithiothreitol, 10 mm MgCl 2 , 0.2 mm GTP) and equilibrated at 50 °C for 10 min. The GN 4 ⁄ 5 ribozyme-tag libraries (2 l m) were mixed in low-salt buffer, added to the total COS-7 RNA and incubated for trans-splicing at 37 °C for 3 h. The trans-splicing reaction was reverse transcribed with primer OP299 using Super- script II RNaseH Reverse Transcriptase (Invitrogen) and amplified by PCR using different forward primers (OP764, OP765, or OP766) and a nested reverse primer (OP763). RT-PCR products were subsequently sequenced by the ABI PRISM BigDyeTerminator Cycle Sequencing Ready Reac- tion Kit (Perkin-Elmer, Oslo, Norway) running on an ABI Prism 377 system (Perkin-Elmer). Table 1. Oligonucleotide primer sequences used in this study. Name 5¢-to3¢ sequence OP299 GCCCGATGCCGACAGCA OP479 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTATACCAGCCTCCCTTGGGCA OP483 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGAGTACTCCAAAACTAATCAATAT OP757 GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT OP758 GGGAATTAATACGACTCACTATAGGNNNNNGATAGTCAGCATGTACGCTGGC OP759 GGGAATTAATACGACTCACTATAGGNNNNTAAAAGCAACTAGAAATAGCGT OP760 GGGAATTAATACGACTCACTATAGGNNNNAGGGGACCTTGCAAGTCCCCTA OP761 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC OP762 GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAA OP763 CAGCAGAATGGTTTCACG OP764 CAGAAGCTCATCCGGCTG OP765 AGCATCACGACGCCGTCA OP766 GCTGTTCTCAGCCTCACT OP816 TCCGGCTGGTAAATGCGC OP887 AATTGCGGCCGCAGAACCTCGCAAGGCCCCCAGCCTGCCGCAAGCTGCTAGCGCGTGCACGTCGACGAATTCAATT OP888 AATTGAATTCGTCGACGTGCACGCGCTAGCAGCTTGCGGCAGGCTGGGGGCCTTGCGAGGTTCTGCGGCCGCAATT OP889 GACGCACGTCAATTGGCCGCTGGATGGGGCCCCTGTGAAGTGTTGCTGAGCAACGCGCTGGCGCG OP890 GGGGGGATCCCTAACCATCCACCTCCTTCC OP891 GGGGTCTAGAGCGTGGTCGTAAAAGTTATCAGGCATGCAC OP892 GGGGGACGTGCGTCGAGTACTCCAAAACTAATC OP893 GGGGGCTAGCGCGTGGTCGTGATAGTCAGCATGTACGCTG OP894 GTGCGTCCTTTATACCAGCCTCCCTT OP895 GGGGGCTAGCGCGTGGTCGTAAAAGCAACTAGAAATAGC OP896 GGGGGACGTGCGTCGGTATGCGCTTAGCCTTAG OP897 GGGGGCTAGCGCGTGGTCGAGGGGACCTTGCAAGTCCCC OP898 GGGGGACGTGCGTCCTTTGTACCGACCTCCGCC OP931 AATTGCGGCCGCCCGCAAGCTGGCGCGCGTAGTCGTTGGCCACGTCTAGACGGGGCACGTCGACGAAATCAATT OP932 AATTGAATTCGTCGACGTGCCCCGTCTAGACGTGGCCAACGACTACGCGCGCCAGCTTGCGGGCGGCCGCAATT OP933 GACGCACGTCGCAAATGATTATGCCAGGCAATTGGCCGCCGGGTGGGGGCCTTGCGAGGTTCTTCT OP934 GGGGTCTAGACGGGGGGTGCAAAAGTTATCAGGCATGCAC OP935 GGGGGACGTGTTGCCGGGCGAGTACTCCAAAACTAATC OP936 GGGGTCTAGACGGGGGGTGCGATAGTCAGCATGTACGCTG OP937 GTGTTGCCGGGCCTTTATACCAGCCTCCCTT OP938 GGGGTCTAGACGGGGGGTGTAAAAGCAACTAGAAATAGC OP939 GGGGGACGTGTTGCCGGGCGGTATGCGCTTAGCCTTAG OP940 GGGGTCTAGACGGGGGGTGAGGGGACCTTGCAAGTCCCC OP941 GGGGGACGTGTTGCCGGGCCTTTGTACCGACCTCCGCC OP948 TTGCTCAGCAACACTTCA OP1079 CCAATTGCCTGGCATAATCA Mph-306R GGGTCTGAAGATGTAGGCACC T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequences FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2797 Plasmid constructions All plasmids were constructed using standard methods [27]. The trans-splicing ribozyme constructs targeting U1357 and U1381 in a-mannosidase mRNA (numbered according to GenBank U60266 starting at the translation initiation codon) were made in several steps. First, the pcDNA3.1(–) vector was digested with NheI and XbaI, and gel purified by the QIAquick Gel Extraction Kit (Qiagen GmbH, Hilden, Germany) generating pcDNA3.1-D. The EGS regions were constructed by hybridization of two comple- mentary oligonucleotide primers (primer combinations OP931 ⁄ OP932 and OP887 ⁄ OP888 for U1357 and U1381, respectively). The annealed primers were digested with NotI and EcoRI and inserted into the corresponding sites in the pcDNA3.1-D vector, generating pAS1357 and pAS1381. Wild type a-mannosidase 3¢-exon sequences, following U1357 and U1381, were PCR amplified with primers carry- ing the restriction enzyme sites BmgBI and BamHI (primer combinations OP933 ⁄ OP890 and OP889 ⁄ OP890 for U1357 and U1381, respectively). The forward primers were used to generate alternative codons for the first 16 and 15 triplets following the target sites U1357 and U1381, respectively. The corresponding PCR products were digested with BmgBI and BamHI and inserted between the BmgBI sites generated by the insertion of EGS regions and the BamHI sites in the multiple cloning sites of the vectors, resulting in pAS1357a and pAS1381a. Ribozymes were amplified and inserted into pAS1357⁄ 1381a between the XbaIorNheI (for U1357 and U1381) site and the BmgBI site. The primer combinations used at U1357 were OP934 ⁄ OP935 for Tth.L1925, OP936 ⁄ OP937 for DiGIR2, OP938 ⁄ OP939 for Fse.L569, and OP940 ⁄ OP941 for Fse.L1898. The primer combinations used at U1381 were OP891 ⁄ OP892 for Tth.L1925, OP893 ⁄ OP894 for DiGIR2, OP895 ⁄ OP896 for Fse.L569, and OP897 ⁄ OP898 for Fse.L1898. The PCR products were then digested with XbaI and BmgBI and ligated into the corresponding vector sites, generating trans- splicing ribozyme constructs targeting U1357 and U1381 in a-mannosidase mRNA. All plasmid constructions were con- firmed by automatic DNA sequence analysis. Oligonucleo- tide primer sequences are listed in Table 1. The in vitro transcription plasmid, pMannRNAa , was generated by amplifying a 1 kb region within the a-mannosidase cDNA by using OP764 and mph306R, and subsequently the PCR product was ligated downstream of the T7 promoter in the pGEM-T easy vector (Promega, Madison, WI, USA). pMannRNAa contains the T1357 and T1381 target posi- tions used in this study. In vitro RNA trans-splicing and time-course analysis Precursor RNAs were transcribed from T7 promoters off linearized ribozyme plasmids. [ 35 S]CTP[aS] (10 lCiÆlL )1 ; Amersham Pharmacia Biotech, Piscataway, NJ, USA) was uniformly incorporated into the RNA transcripts. Tran- scripts were purified by phenol extraction and ethanol pre- cipitation, and dissolved in diethyl pyrocarbonate-treated water. Alternatively, the trans-splicing ribozyme constructs were linearized and transcribed as described above, but without [ 35 S]CTP labelling. Trans-splicing ribozymes were incubated at a 2 : 1 or a 5 : 1 molar ratio, with labelled a-mannosidase target RNA, at 50 ° C for 3 h under splicing conditions (40 mm Tris ⁄ HCl pH 7.5, 200 mm KCl, 2 mm spermidine, 5 mm dithiothreitol, 10 mm MgCl 2 , 0.2 mm GTP). As both molar ratio reactions for all four ribozymes worked equally well, the lowest molar ration (2 : 1) was selected for use in further analyses. Samples were collected at 0, 5, 15, 30, 60 and 90 min, and the reaction was termin- ated by the addition of an equal volume of STOP-solution (95% formamide, 50 mm EDTA, 0,02% xylene cyanol, 0.05% Bromophenol Blue). Reactions were denatured for 2 min at 88 °C and separated on 7 m urea ⁄ 5% polyacryla- mide gels, followed by autoradiography. The PAGE-puri- fied RNAs [28], corresponding to the correct trans-spliced transcripts, were confirmed by RT-PCR and sequencing analysis using the primers OP1079 (for U1357) or OP948 (for U1381) for first-strand cDNA synthesis. The trans-spli- cing junctions were amplified by primer sets OP816 ⁄ OP1079 and OP816 ⁄ OP948 for U1357 and U1381, respectively. Trans-splicing and RPA The trans-splicing ribozyme RNAs were treated with Turbo DNase (Ambion, Huntingdon, UK), according to the manufacturer’s instructions, phenol ⁄ chloroform extracted, ethanol precipitated and dissolved in diethyl pyrocarbo- nate-treated water. Unlabeled trans-splicing ribozymes and PAGE-purified a-mannosidase RNA were mixed at a 5 : 1 molar ratio under splicing conditions (40 mm Tris ⁄ HCl pH 7.5, 200 mm KCl, 2 mm spermidine, 5 mm dithiothrei- tol, 10 mm MgCl 2 , 0.2 mm GTP) and incubated at 50 °C for 3 h. RPA was performed on 5 l Loftrans-splicing RNA mix by using the RNase protection kit (Roche Applied Science, Penzberg, Germany), according to the manufacturer’s instructions. The RPA probes were gener- ated from the RT-PCR products of in vitro trans-spliced a-mannosidase RNA at positions U1357 and U1381 (see above) cloned into the pGEM-T easy vector (Promega). These plasmids were linearized and transcribed, then labelled with [ 35 S]CTP, as described above, to obtain RPA probes of larger sizes than probe fragments protected by trans-spliced RNAs in analysis by RPA. RPA samples were separated on 7 m urea ⁄ 5% polyacrylamide gels, followed by autoradiography and phosphoimager quantification (Fuji BAS 5000 system; image gauge 4.0 software). The cytosine contents in the parts of the RPA probes protected by the differently sized RNAs were calculated and included RNA reprogramming of a-mannosidase mRNA sequences T. Fiskaa et al. 2798 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... 44, 7796–7804 RNA reprogramming of a-mannosidase mRNA sequences 9 Baum DA & Testa SM (2005) In vivo excision of a single targeted nucleotide from an mRNA by a transexcision-splicing ribozyme RNA 11, 897–905 10 Lundblad EW, Haugen P & Johansen S (2004) Transsplicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis Eur J Biochem 271, 4932–4938 11 Einvik C, Fiskaa... Sullenger BA (1998) Ribozyme-mediated repair of sickle betaglobin mRNAs in erythrocyte precursors Science 280, 1593–1596 4 Byun J, Lan N, Long M & Sullenger BA (2003) Efficient and specific repair of sickle beta-globin RNA by trans-splicing ribozymes RNA 9, 1254–1263 5 Watanabe T & Sullenger BA (2000) Induction of wildtype p53 activity in human cancer cells by ribozymes that repair mutant p53 transcripts... basis of the enhanced stability of a mutant ribozyme domain and a detailed view of RNA solvent interactions Structure 9, 221–234 FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors Journal compilation ª 2006 FEBS 2799 RNA reprogramming of a-mannosidase mRNA sequences 24 Sun H & Wolfe JH (2001) Recent progress in lysosomal a-mannosidase and its deficiency Exp Mol Med 33, 1–7 25 Berg T, Riise HM, Hansen... the intensities of differently sized bands comparable The amount of reprogrammed product (RNA2 in Fig 4) was calculated as a fraction (in percentage) of trans-spliced product (RNA2 ) + target a-mannosidase RNA (RNA3 ) + trans-splicing ribozyme (RNA4 ) The amount of reprogrammed product generated by the Tth.L1925 ribozyme was set to 100% to obtain comparable results from the experiments performed in parallel... HEG-containing group I intron in ribosomal DNA Nucleic Acids Res 33, 2042–2051 19 Woodson SA (2002) Folding mechanisms of group I ribozymes: role of stability and contact order Biochem Soc Trans 30, 1166–1169 20 Woodson SA (2005) Structure and assembly of group I introns Curr Opin Chem Biol 9, 1211–1223 21 Takamoto K, Das R, He Q, Doniach S, Brenowitz M, Herschlag D & Chance MR (2004) Principles of RNA. .. repair of a mutant chloride channel using a trans-splicing ribozyme J Clin Invest 110, 1783– 1789 7 Ryu KJ, Kim JH & Lee SW (2003) Ribozyme-mediated selective induction of new gene activity in hepatitis C virus internal ribosome entry site-expressing cells by targeted trans-splicing Mol Ther 7, 386–395 8 Alexander RC, Baum DA & Testa SM (2005) 5¢-transcript replacement in vitro catalyzed by a group I intron-derived... 30, e141 ˚ 14 Haugen P, Andreassen M, Birgisdottir AB & Johansen S (2004) Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing Eur J Biochem 271, 1015–1024 15 Lundblad EW, Einvik C, Rønning S, Haugli K & Johansen S (2004) Twelve group I introns in the same prerRNA transcript of the myxomycete Fuligo septica: RNA processing and evolution Mol Biol... Einvik C, Johansen S & Vogt VM (1995) Two group I ribozymes with different functions in a nuclear rDNA intron EMBO J 14, 4558–4568 ˚ 17 Nielsen H, Fiskaa T, Birgisdottir AB, Haugen P, Einvik C & Johansen S (2003) The ability to form full-length intron RNA circles is a general property of nuclear group I introns RNA 9, 1464–1475 18 Birgisdottir AB & Johansen S (2005) Site-specific reverse splicing of. .. compaction: insights from the equilibrium folding pathway of the P4–P6 RNA domain in monovalent cations J Mol Biol 343, 1195–1206 22 Cate JH, Gooding AR, Podell E, Zhou K, Golden BL, Szewczak AA, Kundrot CE, Cech TR & Doudna JA (1996) RNA tertiary structure mediation by adenosine platforms Science 273, 1696–1699 23 Juneau K, Podell E, Harrington DJ & Cech TR (2001) Structural basis of the enhanced stability of. .. Johansen S (2004) Optimization and application of the group I ribozyme trans-splicing reaction Methods Mol Biol 252, 359–372 12 Kohler U, Ayre BG, Goodman HM & Haseloff J (1999) Trans-splicing ribozymes for targeted gene delivery J Mol Biol 285, 1935–1950 13 Ayre BG, Kohler U, Turgeon R & Haseloff J (2002) Optimization of trans-splicing ribozyme efficiency and specificity by in vivo genetic selection Nucleic . RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes Tonje Fiskaa 1, *, Eirik. (RNA1 ), a-mannosidase tar- get RNA (RNA2 ) and free 5¢ exon target RNA (RNA3 ). M, RNA size marker. T. Fiskaa et al. RNA reprogramming of a-mannosidase mRNA sequences FEBS