mutant cycle analysis as a tool to decipher the structure of the transition state for binding
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ... are already in debt because of the loans they took for their initial investment costs. For the local government it is also important to have a quick solution for the issues at the farms as the shrimp farming ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ...
- 13
- 487
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... ðÀ0:4Þ for the formate flux and Clas Jacetate Clas % ðÀ0:4Þ for the acetate flux 2295 Control analysis of the las operon B Koebmann et al Fig Construction of a strain with the pyk gene deleted from the ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...
- 12
- 616
- 0
Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx
... ceramic then 32 measurements of the sample) was obtained for each sample The absorbance spectrum, represented as a log value(1/R), was obtained by averaging these measurements and comparing them ... content of 6% The meal was mixed and then 15 g was removed with a spatula for disk samples and about g for extreme value samples and placed in a sample cup After the samples had been scanned under a ... available and the number of samples used in the calibration and validation sets for all criteria The descriptive statistics for criteria analysed in the laboratory for these powder samples are...
- 12
- 316
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
... H37Ra (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg ... [26,27] The arthritis severity score for each rat was calculated by adding the scores for each individual paw Measurement of hind paw hyperalgesia and edema The method for measuring hyperalgesia has ... Statistical Package for the Social Sciences software (SPSS Inc Chicago, IL, USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the...
- 7
- 569
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
... references for the relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for ... Reports has published the case of a 22-year-old lactating woman who presented with four months of amenorrhea associated with signs of virilization The patient was diagnosed as having an androgen ... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching...
- 3
- 381
- 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... scores were available for the years 1992–1999; for all other parameters there were no missing data Abdominal surgery and trauma were the most frequent reasons for ICU admission A total of 65,528 ... others have hypothesized that 6.0 mmol/l might not be the best target [19] Therefore, we also performed an analysis of the performance of HGI at cutoff levels other than 6.0 mmol/l As for other...
- 6
- 264
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
... simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and condition effects are given in the table The estimated session factors are all close to the factors ... standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from Figure A: original data B: normalised data ... correct the data As was demonstrated in the previous paragraphs, normalisation and standardisation both use correction factors that can lead to ineffective correction or even to an increased variation...
- 8
- 304
- 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... litres/year 4.3 A comparison between the two cases A comparison of the results of cases I and II shows that the calculated BWF is the same for the two cases This was to be expected because the cases ... World Water Week 2007 in Stockholm, the WBCSD launched the Global Water Tool, a free and easy -to- use tool for businesses and organizations to map their water use and assess risks relative to their ... accurate than the estimates made in the black box case The reason is that in the black box case each PWF is estimated based on the total water footprint of the business, which is allocated to the three...
- 46
- 959
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways, ... [25] The costimulation of phospholipases such as PLC and PLA2 by heat shock and the resultant release of lipid mediators could also enhance the subsequent membrane association and activation of ... properties of the lipid phase [35] The mechanisms highlighted above conceivably also operate in the present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity...
- 10
- 452
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects of care, coordination of care) were combined to form a single domain (coordination ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...
- 8
- 492
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... organizational pockets that seemed to a better job than others Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health...
- 9
- 506
- 0
báo cáo khoa học: " Masculinity as a barrier to men’s use of HIV services in Zimbabwe" potx
... G, Chandiwana S, Anderson R: A critique of early models of the demographic impact of HIV/AIDS in sub-Saharan Africa based on empirical data from Zimbabwe Proceedings of the National Academy of ... (female), patient As many men fail to abide by what is expected of an ART patient, at least until they are more comfortable with their new identity as an ART user and have adopted a more ART-friendly ... given a T-shirt All transcripts were imported into Atlas.Ti, a qualitative analysis software package, through which we began coding the data set For the aims of this paper, we repeatedly read and...
- 14
- 603
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... organizational pockets that seemed to a better job than others Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the ... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health...
- 9
- 412
- 0
Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx
... geo-relational database Each feature has attribute data linked to it which is stored in a table Attributes can be any item of a feature which relate to the map, without being a part of it The attribute ... captured as an ordered string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell in a screen and could be looked at as a ... identifying the location of the case farm and all farms at risk within a specified area of the outbreak Buffer zones can be drawn around those farms as shown in Fig and with a link to tables of the addresses...
- 7
- 341
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... growing list of candidate genes investigated with regard to traits associated with asthma and atopy The most investigated candidate location for atopy and asthma susceptibility loci has been the 5q31–33 ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
- 11
- 491
- 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt
... patient-preferred therapy game (e.g car racing or card playing) The mechanical-assisted training was given supplementary on customary care comprising physical and/or occupational therapy aimed at the maintenance ... functional capacity was assessed with the TEMPA, [27] the Action Research Arm Test (ARAT; normal score = 57) [28] and the 9HPT [29] For the TEMPA, the median execution time of the unilateral activities ... results on the TEMPA and ARAT revealed even greater and for both measures significant gains relative to baseline than immediately after the intervention period, despite the fact that in the meantime...
- 8
- 678
- 0
Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic
... Jan - March 2013 Another direct measurement technique is the ImportancePerformance analysis (IPA) technique IPA was developed by (7) as a tool to ease management decisions The ImportancePerformance ... institutions like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school for Mohiniattam dancer Further, the tourists can learn handicrafts, local cuisines, rural games and mingle ... in a destination and the performance of each item at the destination Based on the above literature this paper, applies the ImportancePerformance Analysis and seeks to develop implications for...
- 7
- 874
- 3
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation of the ... external biotic and abiotic factors Furthermore, at this stage, the main task of the flower bud is to complete the growth and maturation of anthers and the pistil Consequently, the intensity of the ... cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange between pollen and stigma Ca2+ ions are more abundant in the receptive stigmas...
- 12
- 529
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... Journals of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia ... on the transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the ... that was offered was that this “Spanish flu” was actually a different disease Decades later phylogenic testing will find this to be false Other theories were that presence of gas warfare, and...
- 4
- 520
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25