motor cortex control of a complex peripheral apparatus the neuromuscular evolution of individuated finger movements
Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot
... experiences allowed for the verification of veracity and internal consistency, as well as the separation of personal experience from hearsay An additional limitation was the selected nature of the interviewers ... places are so far away, too far away It takes one day to walk there, the whole day Some of the children cough for 1-2 months every day and then the parents make the trip to the town for testing The ... by the people in this area, they are appointed by the government and are part of the government In almost all of the villages I have visited, I see corruption on the part of the village leader...
- 14
- 338
- 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... Lyon, France) for the gift of the HepaRG cells We also thank Deepak Kolippakkam and Neha Lohia for assistance in data analysis and Paul Farley for assistance in the preparation of the manuscript ... transport Proc Natl Acad Sci USA 2001, 98:5306-5311 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi ... and polysomal of the array data by on sucrose gradient Validation Validation of the array data by real time PCR (a) using total and polysome-bound RNA populations and (b) using individual fractions...
- 14
- 384
- 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...
- 8
- 517
- 1
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx
... 5¢-ATTCTAGAG GCTAGGTTGTTGGAAAG-3¢, 5¢-ATTCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢ The two DNA fragments were ligated at the XbaI site and inserted into a cloning vector pBluescript ... domain was then amplified by PCR from the cloned plasmid with primers containing an EcoRI site at the 5¢ end (5¢-TAGAATTCCACCATGCAGGTCTCCCGT-3¢) and an EcoRV site at the 3¢ end (5¢-CAGATATCTTAACAGC ... (Stratagene) As a result of the ligation, the domain to be deleted was replaced by two amino acids, serine and arginine, which were translated from the XbaIsite sequence TCTAGA The cDNA lacking the...
- 10
- 517
- 0
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
... Pharmacotherapies 147 Yuko Kanbayashi and Toyoshi Hosokawa Preface Understanding the rapid changes in the evaluation and management of peripheral neuropa‐ thies, as well as the complexity of their ... dictated, at least in part, by the particular pathology Chronic back pain, for example, is associated with a loss of bilateral dorsolateral prefrontal cortex and unilateral thalamic gray matter ... attack are often overlooked without a complex and careful examination A case in point is the anti-diabetic drug Avandia for which the market approval has been a center of dispute Avandia’s active...
- 172
- 396
- 0
báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx
... cle pair Neural activations of both the shoulder and the elbow musNeural activations of both the shoulder and the elbow muscle pair Tall is the total time of neural activations, the same for the ... 13 Authors' contributions 14 Michela Goffredo was responsible of the markerless part of the research project and of writing the paper Ivan Bernabucci performed the motor control analysis and assisted ... 2006; Karnataka Edited by: Nagabhushan P, Kulkarni L Delhi: Macmillan India; 2006 Kurosawa K, Futami R, Watanabe T, Hoshimiya N: Joint angle control by FES using a feedback error learning controller...
- 12
- 558
- 0
A study of advanced control charts for complex time between events data
... sensitive to large scale shift level and large shape parameter, and the according ARL1 is rather stable regardless of the value of and 1 / Another observation is that the optimal design parameters ... moving average (MEWMA) control charts for the Gumbel’s bivariate exponential (GBE) distributed data, one based on the raw GBE data , and the other on the transformed data The performance of the ... Smoothing factor of the EWMA chart xii L Design parameter for the control limits of the EWMA chart Mean vector of the multivariate distribution Variance-covariance matrix of the multivariate distribution...
- 185
- 189
- 0
AN0532 servo control of a DC brush motor
... Loads extended math library AARG and BARG ; ; ARGUMENTS: A => AARG ; B => BARG ; ; TIMING (cycles): LOADAB MACRO MOVFP MOVFP MOVFP A, B A+ B0,AARG+B0 A+ B1,AARG+B1 B+B0,BARG+B0 ; load lo byte of A ... move and captures the commanded and actual values of position and velocity at the time of the command Read commanded position: P Returns the commanded position count which was captured during the ... incremented by a constant acceleration value until a specified maximum velocity is reached The maximum velocity is maintained for a required amount of time and then decremented by the same acceleration...
- 141
- 797
- 0
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... [19] Hasnain, S.M., Alawaji, S.H., A1 -Ibrahim, A and Smiai, M.S (1999), Application of Thermal Energy Storage in Saudi Arabia International Journal of Energy Research, vol 23, pp 117-124 [20] Zaheer-uddin, ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the system in a local area Second, the DMC controller is a model-based controller ... disturbance By analyzing the temperature at three points in the room and a proper estimation of the environmental disturbance and the heat exchange delay, we have designed a DMC controller to control...
- 12
- 556
- 0
SIMULATION AND SPEED CONTROL OF INDUCTION MOTOR DRIVES
... operating zone of the motor with the variation of load torque Along with the frequency, the voltage was also varied to make V/f ratio constant so that the air gap flux and the maximum torque remain ... this paper, we have studied the various methods of speed control of a 3- induction motor and compared them using their Torque-Speed characteristics Also the transients during the starting of a 3- ... Speed Control of Induction Motor Drives 2012 A MATLAB code was developed to observe the variation in torque-speed characteristics of a 3- induction motor with variable stator voltage The MATLAB...
- 76
- 682
- 0
DC bus control of variable speed wind turbine using a buck boost converter
... work has been supported by the LTE Hydro-Québec, Natural Resources Canada and the Natural Sciences and Engineering Research Council of Canada VII [1] REFERENCES C.L Kana; M Thamodharan and A Wolf; ... increased by two ∆ α d to reach the operating point (k+1) Search rules of the various cases of operation are summarized in the table I 4 TABLE SUMMARY OF CONTROL ACTION FOR VARIOUS OPERATING ... where the switches in the circuit are replaced by their equivalent circuit during each state The circuit diagram for each of the two states are shown in Fig.4 -a and Fig.4-b If the output load current...
- 5
- 574
- 1
Direct torque control of brushless DC motor with non sinusoidal back EMF
... influence of the unexcited open-phase back-EMF causes each straight side of the ideal hexagonal shape of the stator flux linkage locus to be curved and the actual stator flux linkage trajectory ... phase back-EMF for smooth torque generation, there is no easy way to control the stator flux linkage amplitude On the other hand, rotational speed of the stator flux linkage can be easily controlled, ... linkage amplitude because it depends on the size of the sharp dips and the depth of the change may vary with sampling time, dc-link voltage, hysteresis bandwidth, motor parameters especially the...
- 7
- 455
- 3
Direct torque and indirect flux control of brushless DC motor with non sinusoidal back EMF without position sensor
... frame are not constant, therefore current wave shapes require very fast controllers in particular at high speed Classical bandwidth of the controller (such as proportional– integral) does not allow ... linkage trajectory is kept same, however its amplitude is smaller compared to the initial case which means that the flux in the machine is weakened to obtain maximum possible torque above the base ... in the flux-weakening region it was decreased for a certain amount depending on the operational speed to achieve maximum torque .The switching table for controlling both the amplitude and rotating...
- 5
- 617
- 2
Direct torque and indirect flux control of brushless DC motor
... means that the actual value of the torque is above the reference and out of the hysteresis limit and τ = means that the actual value is below the reference and out of the hysteresis limit The same ... estimation algorithm is derived in dq frame consisting of actual dq-axes back EMF constants and currents Instead of the actual back EMF waveforms, Fourier approximation of the back EMFs could have ... line-to-line back EMF waveforms eba (θr e ) and eca (θr e ) are obtained of ine and converted to the ba–ca frame back EMF constants kba (θr e ) and kca (θr e ) The line-to-line Park transformation matrix...
- 10
- 627
- 0
Direct torque control of four switch brushless DC motor with non sinusoidal back EMF
... However, the influence of the unexcited openphase back-EMF causes each straight side of the ideal hexagonal shape of the stator flux linkage locus to be curved and the actual stator flux linkage trajectory ... V7(0101), and (h) V0(1010) torque generation, there is no easy way to control the stator flux linkage amplitude On the other hand, rotational speed of the stator flux linkage can be easily controlled, ... zero as shown in Table I The total electromagnetic torque of PMAC motors equals the summation of each phase torque which is given by Tem 90° Hall-2 Hb where s and s are the – and –axis stator...
- 7
- 616
- 1
Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc
... way the battery will be alway charged a the Maxim t w ys at mum Power P Point The go of the sy oal ystem illustra ated in figure is to supply th as well as single ph i s hree hase loads of any ... to control the DC link vo rter e oltage accord ding to load unbalances In this way t symmetr of the outp voltage i achieved a the linea region of t PWM I the ry put is and ar the modulator o the ... b an arrow in the lift Ω 0Ω R as by and sub diagram This shows the high dy m ynamic perfo ormance of t introduce dead beat control met the ed t thod as the distur a rbance of the output voltage...
- 9
- 650
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... National Association of State Public Health Veterinarians Keith A Clark, D.V.M., Ph.D Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D Office of the Assistant ... regarding the risks and benefits associated with both BCG vaccination and TB preventive therapy They should be informed about a) the variable data regarding the efficacy of BCG vaccination, b) the ... is variable and equivocal The concern of the public health community about the resurgence and changing nature of TB in the United States prompted a re-evaluation of the role of BCG vaccination...
- 27
- 1,309
- 3
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf
... increased because of the effect of palmitoyl-CoA on Dw Control of matrix and extramitochondrial ATP/ADP ratios The control of the ATPin ⁄ ADPin ratio and ATPout ⁄ ADPout ratio is summarized in Table ... Palmitoyl-CoA had hardly any effect on the control of the QH2 ⁄ Q ratio when glutamate plus malate was used as a substrate With succinate, palmitoyl-CoA mainly affected the control of the QH2 ⁄ Q ratio ... to the correlation of [AMP]out and the ATPout ⁄ ADPout ratio predicted by the calculation Palmitoyl-CoA specifically affects the ANT Fig Dependence of AMP concentration on the ATP ⁄ ADP ratio (A) ...
- 15
- 546
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... acid metabolism under anaerobic conditions is expected to result in equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin ... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... rate of interaction with factor Xa brought about by the heparin pentasaccharide-mediated conformational change occurs through a combination of the changes in the structure of the RCL, allowing the...
- 10
- 668
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25