microdissection reverse transcription polymerase chain reaction
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... hợp, sau đó tiế n hành tổ ng hơ ̣p RNA với bô ̣ sinh phẩ m TranscriptA id™ T7 High Yield Transcription Kit (Fermentas) Nồ ng đô ̣ RNA đươ ̣c xác đinh bằ ng cách đo khả hấ p phu ̣...
- 11
- 581
- 0
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot
... Feinstone SM, Levitan H, Gibbs CJ Jr, Gajdusek DC Detection of flaviviruses by reverse transcription polymerase chain reaction J Med Virol 1991, 33, 260-267 Hadfield TL, Turell M, Dempsey MP, David ... 23-35 20 Paranjpe S, Banerjee K Detection of Japanese encephalitis virus by reverse transcription/ polymerase chain reaction Acta Virol 1998, 42, 5-11 21 Puri B, Henchal EA, Burans J, Porter KR, ... RD, Watson R, Gelfand DH Detection of specific polymerase chain reaction product by utilizing the 5-3 exonuclease activity of Thermus aquaticus DNA polymerase Proc Natl Acad Sci USA 1991, 88, 72767280...
- 7
- 334
- 1
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... blood, such as that from a heelstick or finger-prick [2] Quantitative methods for reverse transcriptase polymerase chain reaction (RT-PCR) are rapidly surpassing all other methods of quantifying mRNA ... 0.25 µg of each primer, mM MgC12 in each CD4 reaction and mM MgC12 for CD8 reactions, mM total dNTP's, and 0.5 U of Taq Polymerase For CD4 and CD8 reaction conditions were : 94° for mins, then ... and Maloney murine leukemia virus reverse transcriptase (Promega, Madison, WI), diluted to 3, then µl is used as template in a 25 µl PCR The remainder of the reactions were made up by µl PCR Buffer...
- 4
- 319
- 0
Xây dựng qui trình phát hiện đồng thời yeallow head virus(YHV), taura syndrome virus(TSV) và gill associated virus(GAV) trên tôm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... 1.3.3 Phương pháp sinh học phân tử 20 1.3.3.1.Phương pháp RT – PCR (Reverse – transcription polymerase chain reaction) 20 1.3.3.3 Các thành phần phản ứng PCR 23 CHƢƠNG 2: VẬT ... triphosphate dCTP: Deoxycytidine triphosphate UTRs: Untranslated regions RT-PCR: Reverse transcription polymerase chain reaction kDa: kilo dalton H&E: Hematoxylin EoSin LỜI MỞ ĐẦU Ngày việc khai thác ... Taura syndrome virus(TSV) Gill-associated virus(GAV) tôm kỹ thuật Multiplex Reverse transcription polymerase chain reaction thực nhằm mục đích 11 CHƢƠNG 1: TỔNG QUAN TÀI LIỆU 1.1 Tình hình...
- 59
- 363
- 0
Phát hiện và phân biệt chủng virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn bằng phương pháp multiplex RT PCR (reverse transcription polymerase chain reaction)
... mẫu Polymerase Chain Reaction Phản ứng chuỗi trùng hợp Reverse Transcription Polymerase Chain Reaction Phản ứng chuỗi đồng phân hóa chép ngƣợc mRTPCR Multiplex Reverse Transcription Polymerase Chain ... HỘI CHỨNG RỐI LOẠN SINH SẢN VÀ HÔ HẤP Ở LỢN BẰNG PHƢƠNG PHÁP MULTIPLEX RT-PCR (REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION) Chuyên ngành : Động Vật Học Mã số : 60 42 01 03 LUẬN VĂN THẠC SĨ SINH ... virus gây hội chứng rối loạn sinh sản hô hấp lợn phƣơng pháp multiplex RT-PCR (Reverse Transcription Polymerase Chain Reaction) ” Mục tiêu: Giải trình tự toàn vùng gen ORF7 virus PRRS phân lập Việt...
- 79
- 522
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm AH5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... quy trình phát nhanh virus cúm gia cầm A/H5N1 mẫu bệnh phẩm kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction Labo Trường Đại học Y Thái Bình với mục tiêu: Thiết kế lựa chọn mồi ... đại đoạn khuôn mẫu RNA theo nguyên lý PCR, bao gồm giai đoạn: Giai đoạn 1: Phiên mã ngược (RT -Reverse transcription) khuôn mẫu RNA thành sợi DNA thứ nhất, sau dùng sợi làm khuôn để tổng hợp sợi ... phiên mã ngược thực trước nhờ enzyme Omniscript and Sensiscrip Reverse Transcriptases tiếp đến phản ứng PCR nhờ enzyme Hot Star Taq DNA polymerase Như vậy, tất thành phần phản ứng RT PCR cho vào...
- 78
- 371
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm AH5N1 trong mẫu bệnh phẩm bằng kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction (luận văn thạc sĩ)
... NP: Nucleoprotein NS: Non-structural protein PA: Polymerase A protein PB: Polymerase B protein RT-PCR: Reverse Transcription - Polymerase Chain Reaction RNA: Ribonucleic acid TBE: Tris Base, Acid ... mẫu bệnh phẩm người gia cầm, hầu hết phòng xét nghiệm áp dụng k thuật RT-PCR (Reverse Transcription - Polymerase Chain Reaction) Đây k thuật sinh học phân tử, cho phép phát virus với độ xác cao, ... quy trình phát nhanh virus cúm gia cầm A/H5N1 mẫu bệnh phẩm kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction Labo Trường Đại học Y Thái Bình với mục tiêu: Thiết kế lựa chọn m...
- 80
- 871
- 0
Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx
... molecular detection of carcinoma cells in lymph nodes and peripheral blood by reverse transcriptionpolymerase chain reaction in patients with gastrointestinal or breast carcinomas J Clin Oncol ... detection of disseminated free cancer cells in peritoneal washes with real-time reverse transcriptasepolymerase chain reaction: a sensitive predictor of outcome for patients with gastric carcinoma ... patients with non-small cell lung cancer by real-time fluorescent quantitative reverse transcriptase -polymerase chain reaction in peroperative period J Cancer Res Clin Oncol 2006, 132:248-256 18...
- 8
- 439
- 0
Báo cáo y học: "Expression analysis of three isoforms of hyaluronan synthase and hyaluronidase in the synovium of knees in osteoarthritis and rheumatoid arthritis by quantitative real-time reverse transcriptase polymerase chain reaction" potx
... synovium obtained from control donors and patients with OA or RA, by quantitative reverse transcriptase polymerase chain reaction (RT-PCR), in order to confirm whether message levels differed Materials ... Sequences of the gene-specific oligonucleotide primers and probes for real-time reverse transcriptase polymerase chain reaction Primer and probe HAS-1 Sequence Position 855F GACTCCTGGGTCAGCTTCCTAAG ... and expression levels of the messages were relatively quantified by real-time reverse transcriptase polymerase chain reaction The expression levels of the messages in OA and RA are expressed by...
- 7
- 466
- 0
báo cáo khoa học: "Application of in situ reverse trancriptase-polymerase chain reaction (RT-PCR) to tissue microarrays" pot
... hepatitis C virus genome in formalin-fixed paraffin-embedded liver tissue by in situ reverse transcription polymerase chain reaction J Med Virol 1994, 44:406-409 Martinez A, Miller MJ, Quinn K, Unsworth ... Poulsom R Advantages of in situ hybridisation over direct or indirect in situ reverse transcriptasepolymerase chain reaction for localisation of galanin mRNA expression in rat small intestine and ... single living cells J Nanobiotechnology 2003, 1:2 Grillo M and Margolis FL Use of reverse transcriptase polymerase chain reaction to monitor expression of intronless genes Biotechniques 1990, 262,...
- 5
- 254
- 0
Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx
... sensitivity of the duplex real-time RT-PCR was conducted as follows: the reaction consisted of 10 μL × reaction buffer, 0.2 μL reverse transcription enzyme, 250 nmol/L primers for WEEV and 500 nmol/L ... 12 Hull R, Nattanmai S, Kramer LD, Bernard KA, Tavakoli NP: A duplex realtime reverse transcriptase polymerase chain reaction assay for the detection of St Louis encephalitis and eastern equine ... doi:10.1186/1743-422X-7-284 Cite this article as: Kang et al.: A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis...
- 5
- 278
- 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
... realtime polymerase chain reaction- based method Hepatology 2007, 46:22-31 Chevaliez S, Bouvier-Alias M, Castéra L, Pawlotsky JM: The Cobas AmpliPrep-Cobas TaqMan real-time polymerase chain reaction ... Huang J, Yang CM, Wang LN, Meng S, Deng W, Li JM: A novel real-time multiplex reverse transcriptase -polymerase chain reaction for the detection of HIV-1 RNA by using dual-specific armored RNA as ... GM, Abraham P: Quantitation of hepatitis C virus using an in-house real-time reverse transcriptase polymerase chain reaction in plasma samples Diagn Microbiol Infect Dis 2008, 61:415-420 12 Vermehren...
- 9
- 322
- 0
Báo cáo khoa học: " An analysis of the subtypes of dengue fever infections in Barbados 2003–2007 by reverse transcriptase polymerase chain reaction" pptx
... RNA was extracted from 280 μl of serum using the QIAamp Viral RNA minikit Reverse transcription and polymerase chain reaction was performed using the One-Step Superscript III/RT/Platinum Taq ... does not provide information on the serotype of the virus However, single-step reverse transcriptase polymerase chain reaction (RT-PCR) detection and typing of dengue virus offers a sensitive, specific, ... identified as being dengue positive and selected for confirmation and serotyping by reverse transcriptase polymerase chain reaction In 2003, 45 specimens were analysed of which 14 were males and 31 were...
- 6
- 354
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm A H5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reacti
... NP: Nucleoprotein NS: Non-structural protein PA: Polymerase A protein PB: Polymerase B protein RT-PCR: Reverse Transcription - Polymerase Chain Reaction RNA: Ribonucleic acid TBE: Tris Base, Acid ... HIỆN NHANH VIRUS CÚM GIA CẦM A/H5N1 TRONG MẪU BỆNH PHẨM BẰNG KỸ THUẬT MULTIPLEX REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION Chuyên ngành: Sinh học thực nghiệm Mã số: 60 42 30 LUẬN VĂN THẠC SĨ ... bệnh phẩm người gia cầm, hầu hết phòng xét nghiệm áp dụng kỹ thuật RT-PCR (Reverse Transcription - Polymerase Chain Reaction) Đây kỹ thuật sinh học phân tử, cho phép phát virus với độ xác cao,...
- 79
- 664
- 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
... strain were confirmed by Rapid test which BioNote, Inc produced Multiplex reverse transcription- nested polymerase chain reaction Phylogenetic analysis and detection of CDV in field samples by RT-nPCR ... manufacturer's instructions cDNA synthesis reaction was performed by polymerase chain reaction as described elsewhere using primer Moloney murine leukemia virus reverse transcriptase (M-MLV RT)[6-10] ... Amplification of genomes of different easily infected canine viruses by multiplex reverse transcription- nested polymerase chain reaction Lane 1: positive control of canine distemper virus (CDV) vaccine...
- 6
- 480
- 0
Phát hiện loài Fusarium spp. Gây bệnh thối xương rồng (Cactaceae) bằng phương pháp Polymerase Chain Reaction
... PHÁT HIỆN LOÀI NẤM Fusarium spp GÂY BỆNH THỐI XƢƠNG RỒNG (Cactaceae) BẰNG KỸ THUẬT PCR (Polymerase Chain Reaction) Giáo viên hƣớng dẫn KS DƢƠNG THÀNH LAM TS LÊ ĐÌNH DÔN Sinh viên thực PHẠM THỊ ... “PHÁT HIỆN LOÀI NẤM Fusarium spp GÂY BỆNH THỐI XƢƠNG RỒNG (Cactaceae) BẰNG KỸ THUẬT PCR (Polymerase Chain Reaction) ” phòng Bảo Vệ Thực Vật, Khoa Nông Học trƣờng Đại học Nông Lâm Viện nghiên cứu ... TÀI LIỆU THAM KHẢO 54 PHỤ LỤC 58 DANH SÁCH CÁC CHỮ VIẾT TẮT PCR :Polymerase chain reaction DNA :Deoxyrybonucleotide acid TE :Tris EDTA TAE :Tris Acetate EDTA dNTP :Deoxynucleotide...
- 83
- 373
- 0
ỨNG DỤNG PHƯƠNG PHÁP PCR (POLYMERASE CHAIN REACTION) VÀ PHƯƠNG PHÁP NUÔI CẤY ĐỂ KHẢO SÁT SỰ NHIỄM VI SINH VẬT GÂY BỆNH TRONG THỰC PHẨM ĐƯỜNG PHỐ
... PCR (Polymerase Chain Reaction) Phương pháp PCR phương pháp in vitro để tổng hợp DNA dựa khn trình tự đích DNA ban đầu, khuếch đại, nhân số lượng khn thành hàng triệu nhờ hoạt động enzyme DNA polymerase ... thuật PCR (Polymerase Chain Reaction) PCR phản ứng tổng hợp dây chuyền dùng để khuyếch đại trình tự DNA đích dựa bắt cặp đặc hiệu mồi với DNA mạch khn hoạt tính kéo dài cuả enzyme polymerase ... Mannitol - Egg York - Polymycin NordVal : Nordic System for Validation of Alternative PCR : Polymerase Chain Reaction SE : Relative Sensitivity (Độ nhạy tương đối) SP : Relative Specificity (Độ đặc...
- 84
- 1,791
- 7
Salmonella trong sản phẩm thuỷ sản - Phương pháp định tính bằng kỹ thuật Polymerase Chain Reaction
... có trình tự bổ sung để tạo nên mạch kép 3.6 ADN polymerase enzym tổng hợp nên mạch ADN từ mạch khuôn Phương pháp sử dụng Taq ADN polymerase ADN polymerase hoạt động nhiệt độ cao 3.7 Mồi trình ... AND đích qua chu kỳ gồm bước: biến tính ADN, bắt cặp bổ sung với mồi tổng hợp mạch nhờ enzym ADN polymerase 3.3 ADN đích (target ADN) Trong kỹ thuật PCR, ADN đích hiểu đoạn ADN đặc trưng cho đối ... cao 3.7 Mồi trình tự ADN hay ARN ngắn bắt cặp với mạch khuôn ADN có mang đầu 3' - OH tự giúp ADN polymerase bắt đầu tổng hợp mạch Nguyên tắc Phương pháp định tính dựa vào việc xác định đoạn ADN...
- 8
- 727
- 9
KỸ THUẬT PCR (POLYMERASE CHAIN REACTION)
... ADN polymerase Là enzym xúc tác cho trình lắp ráp nucleotit A, T, G, C vào mạch ADN tổng hợp Ngày người ta dùng nhiều loại ADN polymerase: Taq ADN polymerase, Pfu ADN polymerase, T4 ADN polymerase, ... khai thác để tách dòng sản phẩm PCR Sau Taq ADN polymerase, nhiều ADN polymerase khác phát sử dụng Những ADN polymerase có đặc điểm khác biệt Pfu ADN polymerase tách chiết từ Pyrococcus furiosis ... tin cậy cao lẫn nhân xác ADN I Khái niệm chung Kỹ thuật PCR (phản ứng chuỗi trùng hợp - Polymerase Chain Reaction) phương pháp in vitro để nhân nhanh đoạn AND đó, có độ nhạy cao, mà cần khối lượng...
- 25
- 1,067
- 5
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25