measurement of vitamin c
Measurement of Color, Gloss, and Translucency of White Salted Noodles- Effects of Water Addition and Vacuum Mixing.pdf
... of increased thickness due to cooking Translucency was calculated as translucency %/mm, and all measurements were adjusted to a standard cooked noodle thickness of mm Experiment The effect of water ... used to measure CIE Y for the sample on a black and white Leneta opacity chart Translucency percent was calculated as 100 – ( CIE Yblack/CIE Ywhite) × 100 Statistical Analysis of Results Experiment ... immediately and carefully transferred onto a Leneta opacity chart (Form 2C, Leneta, Mahwah, NJ) for translucency/opacity measurements Measurement of Translucency The Minolta CR-310 was set to CIE x, y,...
- 7
- 660
- 0
The measurement of spasticity
... muscle reaction and the angle of the muscle reaction is patchy There is more focus on the angle of the muscle reaction as opposed to the quality of the muscle reaction A recent review has concluded ... measure of the actual impairment The neurophysiological protocols are capable of directly measuring aspects of spasticity However, most of these tests are cumbersome to carry out in routine clinical ... examination of a commonly used measure of spasticity Clin Biomech, 16: 859–65 Pandyan, A D., van Wijck, F M J., Stark, S et al (2006) The construct validity of a spasticity measurement device for clinical...
- 15
- 515
- 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
... Escherichia coli and mutagenesis of isoleucine-462 Arch Biochem Biophys 353, 109–115 Tuckey RC & Kamin H (1982) Kinetics of the incorporation of adrenal cytochrome P-450scc into phosphatidylcholine ... significance of P450scc-catalysed metabolism of vitamin D and its precursors cannot be underestimated because P450scc-generated hydroxy derivatives of ergosterol and vitamin D2 have biological activity ... repurification were assigned as impurities Other procedures The concentration of cytochrome P450scc was determined from the CO-reduced minus reduced difference spectrum using an extinction coefficient...
- 12
- 704
- 0
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
... Belgian Science Policy; and the Fonds de la Recherche ´ Scientifique Medicale CLL is a fellow of the Fonds National de la Recherche Scientifique (FNRS) References Smirnoff N (2001) l-Ascorbic acid biosynthesis ... involves conversion of UDP-glucuronate to UMP in the lumen of the vesicles and exchange of the latter with cytosolic UDPGlcNAc Once inside microsomes, the latter can, in turn, be exchanged with cytosolic ... presence of sorbinil, an inhibitor of aldose reductase and aldehyde reductase [9], to block the conversion of glucuronate to l-gulonate, and in the presence of UDP-N-acetylglucosamine (UDPGlcNAc),...
- 12
- 659
- 0
The analysis of vitamin c
... endpoint a What is the concentration of vitamin C in the juice in mg vitamin C/ 100 mL of juice (mg/ 100 mL)? b What quantity of juice will provide the RDA amount of vitamin C (mL)? Experiment 3 ... 3‐4 C Data and Calculations C- 1 Standardization of Iodine Solution Sample Mass of Ascorbic Acid Sample (g) Moles of Ascorbic Acid Initial buret reading (mL) Final buret reading (mL) Volume of ... I2 concentration begins to go up and the reaction with the indicator occurs: I (aq) + starch ⎯ starch − I (complex) ⎯→ yellow blue Because an I2 solution cannot be prepared accurately by direct...
- 7
- 729
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA ... (2000) Molecular characterization of tobacco mitochondrial l-galactono -c- lactone dehydrogenase and its expression in Escherichia coli Plant Cell Physiol 41, 666–675 26 Eliceiri GL, Lai EK & McCay PB ... the cystic fibrosis transmembrane conductance regulator chloride channel Proc Natl Acad Sci USA 101, 3691–3696 Brown LAS & Jones DP (1997) Antioxidant action of vitamin C in the lung In Vitamin C...
- 11
- 571
- 0
Measurement of the underlying event in the Drell–Yan process in proton–proton collisions at √ s =7 TeV pptx
... Chinese Academy of Sciences, Ministry of Science and Technology, and National Natural Science Foundation of China; the Colombian Funding Agency (COLCIENCIAS); the Croatian Ministry of Science, Education ... Scientic and Technical Research Council of Turkey, and Turkish Atomic Energy Authority; the Science and Technology Facilities Council, UK; the US Department of Energy, and the US National Science ... University of Belgrade, Faculty of Physics and Vinca Institute of Nuclear Sciences, Belgrade, Serbia P Adzic28 , M Djordjevic, M Ekmedzic, D Krpic28 , J Milosevic Centro de Investigaciones Energộticas...
- 24
- 493
- 0
Báo cáo khoa học: The cytochrome P450scc system opens an alternate pathway of vitamin D3 metabolism docx
... and the local level of P450scc activity Experimental procedures Side-chain modification of vitamin D3 by reconstituted cytochrome P450scc Bovine cytochrome P450scc and adrenododoxin reductase (FDXR) ... Headlam MJ & Tuckey RC (1998) Expression of catalytically 4089 P450scc hydroxylates vitamin D3 active human cytochrome p450scc in Escherichia coli and mutagenesis of isoleucine-462 Arch Biochem Biophys ... 925–929 24 Tuckey RC & Cameron KJ (1993) Catalytic properties of cytochrome P-450scc purified from the human placenta: comparison to bovine cytochrome P-450scc, Biochim Biophys Acta 1163, 185–194...
- 11
- 401
- 0
Báo cáo khoa học: "Automatic Measurement of Syntactic Development in Child Language" docx
... Calculation of IPSyn scores requires a corpus of 100 transcribed child utterances, and the identification of 56 speci c language structures in each utterance These structures are counted and used to compute ... produced by our system Automatic Syntactic Analysis of Child Language Transcripts A necessary step in the automatic computation of IPSyn scores is to produce an automatic syntactic analysis of ... process by using transcripts in electronic format and spreadsheets However, the actual identification of syntactic structures, which accounts for most of the time spent on calculating IPSyn scores,...
- 8
- 580
- 0
Measurement of Organic Chemical Refractive Indexes Using an Optical Time-Domain Reflectometer docx
... velocity of the pulse, s the light-scattering coefficient, f the fraction of scattered light captured at the input end, c the coupling efficiency, τ the pulse width, α the attenuation coefficient ... licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/) ... Introduction Refractive index (RI) is one of the important optical parameters of materials RI sensors have attracted considerable attention in biological and chemical applications This is because...
- 8
- 499
- 0
Quantification of vitamin e and ç oryzanol components in RiceGermandBran
... (B) LC−UV 290 ± 10 nm chromatogram of rice germ extract (C) LC−UV 290 ± 10 nm chromatogram of rice bran without germ extract (D) LC−UV 320 ± 10 nm chromatogram of rice germ extract (E) LC−UV ... Structures of vitamin E and γ-oryzanol components examined in this study However, commercial rice bran is a mixture of rice bran and rice germ (20% of rice bran), and the difference in the chemical ... H]- The spectrum of 7a could not be obtained in LC−MS/MS analysis because of its very low concentration in the dichloromethane fraction milling process According to the information of Riceland Foods,...
- 6
- 649
- 1
Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc
... restriction sites, which contains approximately 170 bp 5¢ upstream region from the initial codon ATG, was prepared using the primers 5¢-AACTGCAGCCGTCCCCACGCCTGCGTCACC-3¢ and 5¢-CGAATTCTCAGGCGCCGCTCTCGCGGAGCA3¢, ... PCR fragment containing R73V ⁄ R84A and FDX1 genes, with HindIII and PstI restriction sites, was prepared using the primers 5¢-ACCAAGCTTATGAAAAGATACCGCCACGACG-3¢ and 5¢-TTCTGCAGTCACCAGGTGACCGGGAGTTCG-3¢, ... uses a bioconversion system of Amycolata autotrophica, which is one of the successful applications of the P450 enzymatic reaction, on an industrial scale [8] The primary structure of the cloned...
- 11
- 505
- 0
Electrical conductivity measurement of silicon wire prepared by CVD
... current gradually increases with increasing the electric field, and finally, a dielectric breakdown phenomenon occurs at high electric fields The ionic current, I, through a dielectric material is given ... X cm, which corresponds to the resistivity of silicon crystal with a purity better than 11 N In Fig 5, the resistivity decreases with increasing voltage and came close to the value of that of ... of Fig seems to be caused by the effect of surface oxide surrounding the silicon core Then, the applied current increased, resulting in the melting of the end of the SiNW contacting the tungsten...
- 5
- 440
- 0
measurement of the pore sizes for anodic aluminum oxide (aao)
... top surface and the pore entrance did not change much during the etching process because the etching rate of the top surface is much slower compared with the etching rate of the pore of AAO in ... pore size of AAO with AFM is investigated AAO film is fabricated by perchloric acid, and it is widened by phosphoric acid Because the etching rate of the top surface of AAO is much slower compared ... fabricated by two step-anodizing at 195 V in a 0.1 M phosphoric acid at C The surface of AAO can be considered a crown shape A material in isotropic wet etchants is generally etched in all directions...
- 5
- 490
- 1
Báo cáo khoa học: An alternative pathway of vitamin D2metabolism Cytochrome P450scc (CYP11A1)-mediated conversion to 20-hydroxyvitamin D2and 17,20-dihydroxyvitamin D2 pot
... above indicate that vitamin D2 can be converted to product(s) of higher biological activity by P450scc Conclusions The novel hydroxylating activity of mammalian P450scc towards vitamin D2 to generate ... P450scc A Slominski et al A B C D Fig NMR spectra of vitamin D2 metabolite identified as 17,20-dihydroxyvitamin D2 (A) Proton spectra of metabolite (B) Proton spectra of vitamin D2 (C) COSY of metabolite ... mitochondria, which contain a high concentration of P450scc, with vitamin D2 Tests were performed in the presence (experimental) or absence (control) of NADPH and isocitrate When the reaction products were...
- 11
- 321
- 0
In this issue: Fair value measurement of financial assets and financial liabilities pdf
... financial statements Disclosure checklist GAAP comparison IFRS compared to US GAAP Sector-specific issues IFRS Sector Newsletters Application of IFRS Accounting under IFRS Impact of IFRS For access ... distinguish a characteristic of an asset or liability from a characteristic arising from an entity’s holding of the asset or liability, which is an entity-specific characteristic Factors used to ... lock-up provision is determined to be a characteristic of the security and not entity-specific based on the specific terms and nature of the restriction In that case, the restriction would be considered...
- 33
- 498
- 0
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt
... Sequence ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC ... available, we decided to screen for amino acids involved in zinc chelation by site-directed mutagenesis Sequence comparison revealed a CX2GX7CXC motif which occurs in all cyclohydrolase II sequences (Fig ... GTP cyclohydrolase II, although it lacks the characteristics of a kinetically competent intermediate [13] We conclude that the catalytic action of zinc is required for the hydrolytic opening of...
- 7
- 367
- 0
MEASUREMENT OF ATMOSPHERIC DEPOSITION UNDER FOREST CANOPIES: SOME RECOMMENDATIONS FOR EQUIPMENT AND SAMPLING DESIGN docx
... walls of the collector during dry periods, as occurs in continuously open collectors Downwash of the dry-deposited compounds can significantly affect the composition of the sample collected in continuously ... species yield large amounts of water 2.2 DESIGN OF THE COLLECTORS AND SAMPLING ACCURACY 2.2.1 Incident Precipitation and Throughfall Sources of errors The accuracy required for the measurement of ... However, the use of tubes is inadvisable when careful cleaning is necessary Cleanliness of all parts of the collecting device is especially critical in the case of funnel-type gauges, which sample lower...
- 35
- 411
- 0
IN THIS ISSUE: PRESENTATION AND MEASUREMENT OF FINANCIAL ASSETS CARRIED AT FAIR VALUE potx
... publications, which discuss speciic requirements of pronouncements Disclosure checklist IFRS-related technical information also is available at kpmg.com/ifrs For access to an extensive range of accounting, ... Horizon publications, which discuss consultation papers First Impressions publications, which discuss new pronouncements Newsletters, which highlight recent accounting developments IFRS Practice Issue ... amortised cost in the foreign currency of 461,708 is sourced from Example The amortised cost in the functional currency of 784,904 is calculated by applying the period end spot exchange rate of 1.7...
- 15
- 402
- 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
... J, Uchida Y, Iwase O, Gotoh A, Kawanishi Y & Toyama K (1998) Vitamin K2 selectively induces apoptosis of blastic cells in myelodysplastic syndrome: flow cytometric detection of apoptotic cells ... viability of synovial cells These results indicate that MK-4 exerts cytotoxic effects on synovial cells and this may be secondary to its side chain structure Oral administration of MK-4 ameliorates collagen-induced ... Vitamin K2 combined with all-trans retinoic acid induced complete remission of relapsing acute promyelocytic leukemia Br J Haematol 103, 584–585 14 Firestein GS (2003) Evolving concepts of rheumatoid...
- 7
- 455
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008