0

mapk and nitric oxide no mediated intrinsic pathway signaling constitutes a critical component of apoptotic signaling in male germ cells after hormone deprivation

Báo cáo y học:

Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"

Y học thưởng thức

... nNOS and increased activity may be mainly by iNOS due to expected inflammation after anoxia The Figure shows activities of AS, AL and arginase in the study AS and AL activities increased in all ... Kawahara K, Gotoh T, Oyadomari S, et al Co-induction of argininosuccinate synthetase, cationic amino acid transporter-2, and nitric oxide synthase in activated murine microglial cells Mol Brain ... production of ornithine Co-induction of AS, cationic amino acid transporter-2, and NOS in activated murine microglial cells (19) and co-induction of inducible NOS and arginine recycling enzymes in cytokine-stimulated...
  • 8
  • 622
  • 0
Báo cáo y học:

Báo cáo y học: " The anti-inflammatory effects of the tellurium redox modulating compound, AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages" doc

Báo cáo khoa học

... down-regulation of IkappaB kinase and NFkappaB activation in macrophages Biochem Pharmacol 2000, 60:1665-76 Kabe Y, Ando K, Hirao S, Yoshida M, Handa H: Redox regulation of NFkappaB activation: distinct ... to its ability to reduce pro-inflammatory cytokines and inhibit iNOS expression and NO release in LPS-stimulated RAW264.7 macrophages by targeting the NFB activation pathway Materials And Methods ... AS101, are associated with regulation of NFB signaling pathway and nitric oxide induction in macrophages Journal of Inflammation 2010 7:3 Publish with Bio Med Central and every scientist can read...
  • 8
  • 581
  • 0
Báo cáo y học:

Báo cáo y học: "Involvement of nitric oxide (NO) in cough reflex sensitivity between non-sensitized and OVA-sensitized guinea pigs" pptx

Báo cáo khoa học

... Ono Pharmaceutical Co Ltd (Osaka, Japan) ONO1714 was dissolved in normal saline at doses of 0.1 and 0.3 mg/kg Vehicle (normal saline) and ONO1714 solution were first intraperitoneally administered ... quarantined at the Animal Research Center of Kanazawa University All animal procedures in this study conformed to the standards set in the Guidelines for the Care and Use of Laboratory Animals ... et al [22] Guinea pigs weighing 150-200 g were intraperitoneally administered with 2.0 mg of OVA and 100 mg of aluminum hydroxide [Al (OH)3] two days after an intraperitoneal administration of...
  • 9
  • 306
  • 0
Báo cáo khoa học: Space, time and nitric oxide – neuronal nitric oxide synthase generates signal pulses pptx

Báo cáo khoa học: Space, time and nitric oxide – neuronal nitric oxide synthase generates signal pulses pptx

Báo cáo khoa học

... pulse generated by starting and stopping with a s interval, pulse after a s interval, pulse after simultaneous injection of EDTA and Ca+2, pulse after s interval, and pulse after s interval (B) Segments ... solutions of nNOS, mm arginine, 12 lm calmodulin and 100 lm CaCl2 in air-saturated BTP at pH 7.5 with mm NADPH Data collection and preliminary analysis of spectral stopped flow data was performed using ... spectrum of nNOS, NADPH and arginine from the spectrum of nNOS, NADPH and arginine, s after initiation of turnover in air-saturated buffer ( 150 torr O2) The lower trace in Fig shows a difference...
  • 12
  • 402
  • 0
Báo cáo khoa học: Transport of L-arginine and nitric oxide formation in human platelets pdf

Báo cáo khoa học: Transport of L-arginine and nitric oxide formation in human platelets pdf

Báo cáo khoa học

... (1999) Pharmacokinetics of intravenous and oral L-arginine in normal volunteers Br J Clin Pharmacol 47, 261–266 16 Deves, R & Boyd, C .A (1998) Transporters for cationic amino acids in animal cells: ... Moreover in endothelial cells [36] extracellular L-arginine concentration is the most determinant of L-arginine availability for cNOS, despite the fact that intracellular arginine concentrations greatly ... Km of endothelial NOS [37] The compartmentalization of L-arginine within cells may explain the dependence of NO synthesis on extracellular L-arginine despite saturating intracellular substrate...
  • 8
  • 401
  • 0
Báo cáo y học:

Báo cáo y học: "Ex vivo effects of flavonoids extracted from Artemisia herba alba on cytokines and nitric oxide production in Algerian patients with Adamantiades-Behcet''''s disease" pptx

Báo cáo khoa học

... Dictionary of Traditional Chinese Medicine Shanghai Science and Technology Press, Shanghai 1977, 627 24 El-Thaher TS, Matalka KZ, Taha HA, Badwan AA: Ferula harmonis zallouh and enhancing erectile ... disease patients Scand J Rheumatol 2002, 31:205210 Sugi-Ikai N, Nakazawa M, Nakamura S, Ohno S, Minami M: Increased frequencies of interleukin-2- and interferon-gamma producing T cells in patients ... examined nitric oxide production as a marker of the inflammatory response in the PBMC of patients with Adamantiades-Behỗets disease (ABD) Artemisia herba alba may represent an alternative therapy...
  • 31
  • 417
  • 0
báo cáo khoa học:

báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

Báo cáo khoa học

... NRP -A and NRP-B, an ubiquitin-associated (UBA) protein homolog and NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved ... Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression profiles of ... osmotic- and ER-stress integrating pathway, also called the integrated pathway The enhanced accumulation of membrane-associated NRPs activates a cascade to induce the expression of the nuclear transactivator,...
  • 14
  • 254
  • 0
báo cáo khoa học:

báo cáo khoa học: " Auxin and nitric oxide control indeterminate nodule formation" ppt

Báo cáo khoa học

... 5'TGGAAGGATCAACAGTGCCA-3'; MtLAX1 forward primer 5'-AAACAAGGCGAAGAAACAA-3', reverse primer 5'-ACAGCTAAACCAAGCATCAT-3', MtLAX2 forward primer 5'-ATGTTGCCACAAAAACAAGG-3', reverse primer 5'-TGAATGAATGATCTTCCACC-3'; ... 3A and Fig 4A) Both M truncatula and M sativa plants bearing IAA-overproducing nodules had a more developed root apparatus in comparison with plants nodulated by the control strain (Fig 3C and ... Expression of auxin carrier genes in Medicago truncatula Expression of auxin carrier genes in Medicago truncatula roots Expression levels of auxin efflux (PIN1 and PIN2) and influx (LAX1, LAX2 and LAX3)...
  • 11
  • 94
  • 0
Báo cáo y học:

Báo cáo y học: "Atrial natriuretic peptide infusion and nitric oxide inhalation in patients with acute respiratory distress syndrome" ppt

Báo cáo khoa học

... in arterial oxygen saturation and a decrease in the alveo- Another explanation for our results may be that ANP did not produce clinical effects because there was already a maximal vasodilating ... with the same baseline plasma levels of cGMP The increase of cGMP was higher after NO inhalation than after ANP infusion, suggesting that the administered dose of ANP may have been too low Indeed, ... cm5/m2) Inotropic support (µg/kg/min) Organ failure Survival Critical Care Data of the various substrates and variables measured during atrial natriuretic peptide (ANP) infusion Baseline ANP infusion...
  • 7
  • 279
  • 0
Sphingosine kinase 1 regulates the expression of proinflammatory cytokines and nitric oxide in activated microglia

Sphingosine kinase 1 regulates the expression of proinflammatory cytokines and nitric oxide in activated microglia

Kỹ thuật - Công nghệ

... CCA GGAAAGCAACCACGGGCACA 314 507 5’GCTTCGAGTCCTGACCCA 3’ 5’GGCCACTTGTCTCTCGAT 3’ 5’ACTGTTGGAGACAGACTGAA CG 3’ 5’ TGGAGACTTCTGCCCATT 3’ 5’CAGGTCCGACAAAGTGAG 3’ 29 80120 2.5 µl of cDNA was used ... glutamate (Nakajima, et al., 2001) Microglia can facilitate the apoptosis and phagocytosis of infiltrating T cells through various signaling pathways leading to a subsequent down regulation of ... GACCT 3’ 5’CTCTACTCCAAGGGCT S1P4 ATGT 3’ 5’GTGTGTGCCTTCATTG S1P5 TG 3’ Antisense CGGACTCCGCAAAGTCTAAG Size (bp) 205 AGGCCACAGGTATTTTGTCG 229 CTCACTGGGACAGCACAGAA 217 GGATGCCACAGGATTCCATAC CCA...
  • 109
  • 222
  • 0
A discourse analysis of film reviews in english and vietnamese

A discourse analysis of film reviews in english and vietnamese

Khoa học xã hội

... main contents of the film, but the name of the film is always present in both languages Two parts that are always present are name of the film and director in EFRs and name of the film and main ... RATIONALE Nowadays, there are many ways of entertaining Films are a popular source of entertainment and it is also considered to be an important art form, a powerful method for educating or indoctrinating ... inductive and reductive methods are inevitable 3.3 RESEARCH PROCEDURES 3.4 DATA COLLECTION AND ANALYSIS 3.4.1 Data Collection 3.4.2 Data Analysis 3.5 RELIABILITY AND VALIDITY 10 CHAPTER FINDINGS AND...
  • 13
  • 1,651
  • 4
A discourse analysis of book reviews in english and vietnamese

A discourse analysis of book reviews in english and vietnamese

Khoa học xã hội

... Great Britain, The United States of America, Canada, and Vietnam 3.5 DATA ANALYSIS Collected data will be mainly analyzed on the basis of the following points: Layout, lexical features, syntactic ... evaluation, and the thing evaluated the part or aspect of the book evaluated The evaluative category is a category which actually evaluates the thing evaluated, and the evaluating response is the evaluator’s ... Halliday and Hassan (1976:12) [22] view Text as a “semantic unit” characterized by cohesion or a framework that is logical and general and use Discourse to explain Text A text is a passage of...
  • 13
  • 2,023
  • 4
A comparative study of lexical cohesion in english and vietnamese newspaper articles

A comparative study of lexical cohesion in english and vietnamese newspaper articles

Khoa học xã hội

... included in that of the other (Hyponym) For example, one cannot say an animal is a cat By contrast, it is accurate to say that a cat is an animal That is, the meaning of animal is included in the meaning ... native of Egypt, was military leader of al Qaeda in Iraq Al-Baghdadi was leader of the Islamic State of Iraq, an umbrella group that includes al Qaeda in Iraq (CNN, April 25, 2010 Updated 1023 GMT ... adjectives and adverbs, particularly the later, are repeated in a very limited rate Almost all of adjectives and adverbs in newspaper articles have neutral nuances of meaning and they are used...
  • 73
  • 1,661
  • 4
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Báo cáo khoa học

... combination of a- and b-subunits, each a- subunit bearing an Fe2S2 cluster and a mononuclear iron site [208] Two histidines and one bidentate aspartate ligand, the socalled ễ2-His-1-carboxylate facial ... Wada, A. , Ogo, S., Watanabe, Y., Mukai, M., Kitagawa, T., Jitsukawa, K., Masuda, H & Einaga, H (1999) Synthesis and characterization of novel alkylperoxo mononuclear iron(III) complexes with a ... myoglobin and hemoglobin by nicotinamide adenine dinucleotides and avins J Biol Chem 244, 67026706 151 Adams, P .A & Berman, M.C (1982) Hemin -mediated para hydroxylation of aniline: a potential model...
  • 26
  • 746
  • 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Báo cáo khoa học

... described in the Materials and methods (A) Cells after medium renewal; (B) cells after medium renewal and h of hypoxia (200 p.p.m.); (C) the same cells after h of hypoxia (200 p.p.m) and h aerated incubation ... staining of replicating DNA and DNA-bound PCNA To demonstrate the connection between active DNA replication and the appearance of bound PCNA in nuclei, simultaneous immunodetection of replicating ... the activating kinase(s) of the complex, after medium renewal before and at the end of hypoxic gassing as well as under normoxic conditions As shown in Fig MCM3 and Cdc6 are not, and MCM2 and...
  • 11
  • 610
  • 0
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

Báo cáo khoa học

... characterization and use of monoclonal antibodies against the major extracellular human cysteine proteinase inhibitors cystatin C and kininogen Scand J Clin Laboratory Invest 48, 573–582 Bjarnadottir, ... Downstream primer (5¢-to 3¢) Annealing temp (°C) Seg size (bp) TGA AGC TGG AAA CCA TCA TTC AAA ACA TTA GCA GGA ATT TTC 52 343 GGA GTT CTG CCA GGG AAC CAC GTG CTG CCT GAG AAG GAT TG GAC AGG GGA GAA ... (containing nuclei and cell debris), a heavy and a light fraction containing mitochondria and various cell organelles, and a supernatant containing the smallest cellular vesicles Cystatin F, cystatin...
  • 10
  • 536
  • 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học

... (total proteins) of a lysate of strain SCH9-HA (lane 1) As a reference, the anti-HA resin was incubated with a lysate of wild-type strain W303, in which SCH9 has no tag (lane 2), or with no lysate ... structure Finally, our data are consistent with a In this article, we describe a novel S cerevisiae signaling pathway that implicates Bud32p and Sch9p (yeast homologs of mammalian PRPK and Akt ⁄ PKB, ... Kodak 1d image software Monoclonal antibodies against phosphoserine (cat no P3430) (anti-pSer), polyhistidine (cat no H1029) (anti-His) and HA (cat no H9658) were from Sigma, and monoclonal antibody...
  • 15
  • 414
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Uniform Treatment of Pragmatic Inferences in Simple and Complex Utterances and Sequences of Utterances" pot

Báo cáo khoa học

... be cancelled We are not aware of any formalism or computational approach that offers a unified explanation for the cancellability of pragmatic inferences in general, and of no approach that handles ... suppositions in a logical framework that handles defaults (Reiter, 1980), but this approach is not tractable and it treats natural disjunction as an exclusiveor and implication as logical equivalence ... information and that information can be more easily updated in the future T h a t means that if an interpretation m0 makes an utterance true by assigning to a relation R a defensible status,...
  • 7
  • 418
  • 1
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học

... Belgium) and Dr Inari Kursula (University of Oulu, Finland) are gratefully acknowledged This study was supported by the Academy of Finland (grant 200966) 6146 References Haapalainen AM, Merilainen ... determined and analysed: the structure of a complex of CoA with the C8 9A variant and a complex of CoA bound in the active site with an oxidized Cys89 The latter structure was obtained from a soaking ... interactions at the thiolase active site G Merilainen et al ¨ Table Calorimetric analysis of CoA binding to the Z ramigera biosynthetic thiolase at 25 °C The values and error estimates are calculated...
  • 13
  • 472
  • 0

Xem thêm