lt b gt active the company has ordered some new equipment passive some new equipment has been ordered by the company
the first chapter will start with the introduction to the problem that mai dong mechanical company has been facing and also the research design and methodology of the research
... requirements The HR turnover of the company has become higher and higher The company lost many key persons whose positions has still been vacant and need to be fulfilled by other excellent candidates The ... encourages their loyalty to devote their talents to their current jobs Hence, the good benefit and compensation policy should be offered to ensure the mutual benefit of the staff and also the company Then ... continuously They have performed their works by their experiences As a consequence, this has made staff not be able to solve arising difficulties by themselves It means that they could not fully meet the...
- 51
- 382
- 0
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf
... regions, iab-5, is thought to be active, while the other three are silenced In A6, both iab-5 and iab-6 are active, and iab-7 and iab-8 are silenced, but only iab-6 drives the expression of Abd -B Similarly, ... challenged by the same promoter on the homolog chromosome For Abd -B, it has been revealed that enhancers in the iab-7 cis-regulatory unit can indeed regulate, albeit weakly, the Abd -B promoter ... and scs, are compatible with this possibility [22] If Fab-7 is replaced by either of these boundaries, communication will be blocked between the proximal enhancers and Abd -B The simplest interpretation...
- 7
- 719
- 0
Update to Notice of Financial Institutions for Which the Federal Deposit Insurance Corporation has been Appointed Either Receiver, Liquidator, or Manager pot
... New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New York New ... Kansas Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska Nebraska ... The Blissfield State Bank Byron Bank CSB Bank Exchange State Bank Central Macomb Community Credit Union Southern Michigan Bank...
- 15
- 512
- 0
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... A biochemical study by Ausili et al on the hyperthermostability of the b- glucosidase from P furiosus suggested that the enzyme is mainly stabilized by hydrophobic interactions, and that it has ... Kelly [22] The diagram shows that at low pressures, b- glucosidase is stabilized by pressure against thermal denaturation, which has also been observed for other glucosidases [27] The enzyme becomes ... the band at 1.0 GPa in Fig 5C does not resemble the broad, featureless band typical of an unfolded protein Taken together, these observations suggest that the unfolding at the level of the...
- 9
- 340
- 0
Báo cáo Y học: Role of conserved residues within helices IV and VIII of the oxaloacetate decarboxylase b subunit in the energy coupling mechanism of the Na+ pump ppt
... but the binding becomes much weaker as emphasized by the dramatic increase of the Na+ ion concentration required to saturate the enzyme Both mutant decarboxylases were inhibited by Na+, and the ... were inhibitory These results implicate that the Na+ binding of the decarboxylase (Km % mM) was dramatically affected by the S382A mutation We also investigated the stability of OadB with the S382A ... the Na+ pump (A) shows the empty binding site region with enzyme-bound carboxybiotin (B- COO–), exposing the Na+ binding sites toward the cytoplasm (B) shows the situation where the first Na+ binding...
- 8
- 508
- 0
Báo cáo khoa học: Mutagenesis at the a–b interface impairs the cleavage of the dystroglycan precursor doc
... P565A (Fig 1) The affinity of each mutant towards the soluble recombinant biotinylated b- DG ectodomain, b- DG(654–750), was measured by solidphase binding assays Although solid-phase binding assays ... and the deletion of the entire b- DG binding epitope between amino acids 550–565 (C and D) A lower band, at about 50 kDa, probably originates from further proteolysis of b- DG-GFP The black boxes ... faint band at about 160 kDa, probably caused by a small amount of the uncleaved DG precursor, pre-DG, which spans both the a- and b- subunits of DG (Fig 3A ,B, E) Interestingly, the two DG FEBS Journal...
- 13
- 268
- 0
Phụ âm /b/ - phát âm thế nào? docx
... hành BULL BET BEACH BAT BEER Nghe nhắc lại từ sau đây: buy bird bread rubber about able job web globe Các b n lắng nghe câu sau nhấp nút play nhiều lần để thực hành câu có chứa phụ âm /b/ cách ... chảy: “Bernie brought a big breakfast back to bed” Dường b n vất vả luyện tập với phụ âm /b/ mời b n lắng nghe hát Letter B để thư giãn Imagine how our lives would be Without the letter B Instead ... rung B y b n tưởng tượng tự thực hành cách phát âm phụ âm /b/ Theo dõi video sau để kiểm tra xem thực hành chưa thành thạo với phụ âm /b/ b n nhé: Sau số ví dụ từ có chứa phụ âm /b/ để b n tự...
- 4
- 378
- 0
Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf
... -Rattus norvegicus CCCGTTAACCTGACGCGTTTGTGTTCTCCAGTTTCTAACGTGGGTCGGCCGGGGGAG GCACAT-ATTTCCCCTCGCCCGGTGTCCCTCCGCCACGTCTTCGCCCAGACAGACAT -: Bos taurus :CCCGTTCGCCCGACGCGTTTGTGTTCCCCAGTTCCTAACA ... :CACACACACACACCACCACCACAAACGGGACCACCACCTAAGGTACGCGTCAAGACAGGGTGTATAGTCCTTTACTCCACTGGTAGTC-CCGTTCTTTCCTTCCCCC ACCCACGTCCCGCTAA Bos taurus : AAAACA -ACCTAAGGTGGGTGCCCAGACAAGGTCTCCAGTCCTTTACTCCACTAGTCGGGGCCGCTCCTTACTTCCCCCT-CCCGACTCCCCTCTAA ... :CCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA -Mus musculus :CCCGTTAACCTGACGCGTTTGTGTTCTCCAGTTTCTAACGCGGGTCGGCCGGGGGAGGGAGGCACGT-ATTTCCGCTCGCC...
- 12
- 371
- 0
Pulmonary tuberculosis associated with increased number and percentage of natural killer and B cells in the peripheral blood pot
... molecules between the patients with PTB and normal healthy individuals Table shows the comparison of the absolute number of various peripheral blood lymphocyte subsets between the PTB patients ... lymphocyte subsets abnormalities in PTB that there has been no agreement on understanding the mechanisms underlying the disease process This issue is further complicated by the fact that peripheral blood ... peripheral blood lymphocyte subsets including NK cells in PTB have already been described in PTB (Snyder et al., 2007; Barcelos et al., 2008) CD4 + T-cells have been shown to play a vital role in the...
- 5
- 419
- 0
Annual compilation and accounting report for Annex B Parties under the Kyoto Protocol ppt
... Annex B, 3 and the European Community.4 All 39 Annex B Parties submitted their initial reports; 34 of these submitted their initial reports by the date stipulated by decision 13/CMP.1, and five (Bulgaria, ... under the Kyoto Protocol have been recorded in the CAD for all Annex B Parties reviewed Table Status of the submission and review of the initial reports Party Australia Austria Belarusb Belgium Bulgaria ... include Belarus in Annex B to the Kyoto Protocol has not been ratified by the required number of Parties and therefore has not yet entered into force Croatia became a Party to the Kyoto Protocol on...
- 14
- 519
- 0
Báo cáo khoa học: De novo synthesis, uptake and proteolytic processing of lipocalin-type prostaglandin D synthase, b-trace, in the kidneys pptx
... glycopeptidase F and used for western blot analysis with MAb- 1B7 , MAb-5C11 and MAb-10A5 Truncated forms of L-PGDS were detected by MAb- 1B7 and MAb-10A5, but not by MAb-5C11 Positions of molecular size ... in the tubules was observed in perinuclear regions by in situ hybridization and by immunostaining with MAb-5C11 (Fig 3M, N) Although punctuate structures were seen by immunostaining with MAb-10A5 ... almost the same affinity, in either the soluble or immo7148 bilized state The binding affinity of MAb-5C11 for immobilized b- trace was approximately fivefold higher than the affinities of MAb- 1B7 and...
- 13
- 525
- 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt
... b- Fuc4N RR; b- Fuc4Nac RR; b- Qui4N PP; b- Qui4N PP¢; b- Qui4NAA PP; b- Glc KK; 5,6 b- Glc KK; 1,2 b- Qui3N Y; 5,6 b- Qui3NAc Y; 1,2 b- Qui3N Y¢; b- Qui3NAc Y¢; b- Qui3N V; 5–7 b- Qui3NAc V*; 1–3 deac b- Qui3NAc4Ac ... to the observation of a signal at m ⁄ z 199.2, corresponding to a cyclic AA component The cyclic structure of the AA was confirmed by the observation of the weak C-5: H-2 HMBC correlation There ... understanding of the molecular basis of their biological properties, the host specificity and diversity of members of this important bacterial genus, as well as the nature of its pathogenicity The results...
- 12
- 397
- 0
Báo cáo khoa học: Synthesis of b-mannosides using the transglycosylation activity of endo-b-mannosidase from Lilium longiflorum pptx
... Manb1–4GlcNAcb1-pNP Manb-Manb-GlcNAcb1-pNP Manb-Glcb1-pNP Manb-Manb-Glcb1-pNP Manb-Manb1-pNP M3C-PA, M 4B- PA and M5A-PA has been reported previously [23] Transglycosylation activity of endob-mannosidase ... yield, respectively, although stereo-selectivity has not been achieved [11] The core trisaccharide of the N-linked sugar chain, Manb1-4GlcNAcb1-4GlcNAc, has been synthesized using the transglycosylation ... GN2-PA (the structures and abbreviations for sugar chains are listed in FEBS Journal 272 (2005) 1660–1668 ª 2005 FEBS Abbreviation Structure GN2 M1 M 2B M 3B M3C M 4B M5A Table 1), which are the hydrolysis...
- 9
- 576
- 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... by us and other investigators for TPa [4,6,7] While it has been reported that the optimum 5¢ UTR length for ribosomal binding is 40–50 bp, sequences of 12–15 bp, such as that found in the TPb ... analysis using the primer Kin46 did result in the amplification of a TPb specific product of 1003 bp (Fig 5B, lane 2) that was confirmed by Southern blot analysis (Fig 5C, lane 2) and by nucleotide ... and ERb isoforms has been shown to be responsible for the disparate distribution of both receptors [47,48] In the case of the murine calcitonin receptor, three individual promoters direct the expression...
- 16
- 321
- 0
Báo cáo sinh học: " Oral administration of IFN-a2b-transformed B. longum protects the Balb/c mice against coxsackievirus B3-induced myocarditis" pptx
... expression by this bifidobacteria in mice might be induced persistently by L-arabinose in MRS or by the administered food and then enter the blood circulation by gastrointestinal absorption [13] ... and its probiotic properties have been extended further by the production of the recombinant Bifidobacterium-containing products [7-11] Genetically engineered Bifidobacterium has been reported ... hIFN-α 2b level can be enhanced in the mice that have been administrated orally with B longum [12,13] As we know, the expression of hIFN-α 2b in IFN-transformed B longum is mainly induced by L-arabinose,...
- 15
- 164
- 0
Báo cáo hóa học: " Oral administration of IFN-a2b-transformed B. longum protects the Balb/c mice against coxsackievirus " pot
... expression by this bifidobacteria in mice might be induced persistently by L-arabinose in MRS or by the administered food and then enter the blood circulation by gastrointestinal absorption [13] ... and its probiotic properties have been extended further by the production of the recombinant Bifidobacterium-containing products [7-11] Genetically engineered Bifidobacterium has been reported ... hIFN-α 2b level can be enhanced in the mice that have been administrated orally with B longum [12,13] As we know, the expression of hIFN-α 2b in IFN-transformed B longum is mainly induced by L-arabinose,...
- 15
- 294
- 0
Tỉ lệ Thải trừ virus viêm gan siêu vi B khỏi cơ thể pdf
... gan B khỏi thể Y học dùng xét nghiệm sinh học xét nghiệm HBsAg (kháng nguyên vỏ siêu vi B) , Anti-HBc (kháng thể lõi siêu vi B) để kiểm tra xem b nhiễm siêu vi B hay không xét nghiệm Anti-HBs ... hợp Theo thống kê B nh viện ghi nhận: - Tỉ lệ thải trừ HBV viêm gan siêu vi B cấp người lớn 90% - Tỉ lệ thải trừ HBV viêm gan siêu vi B mãn tính khoảng 1% Nếu trước người có kết xét nghiệm HBsAb ... 15-20% Khi nhiễm HBV mãn tính (đây trường hợp b n quan tâm), tỉ lệ thải trừ HBV năm 0,5-2% Cũng cần lưu thải trừ HBsAg (-), tổn thương di chứng hậu HBV gây tồn Vì cần theo dõi, phát biến chứng (viêm...
- 4
- 350
- 0
Honda environmental annual report 2001 this report has been compiled forcusing on the environmental conservation activitieshonda undertook in japan in the fiscal 2000
... plans are established by the individual active departments on the basis of mediumterm policies determined by the Executive Committee These plans are then discussed and approved at the Environmental ... into the effluent is due to the change in the type of paint used on the new paint coating line In the past the paint had been a solvent type and on the new line this is a water-based paint Although ... compulsory under the Water Pollution Control Law and the Bylaws ・ of the Local Government Authorities ・ listed data have been obtained by statistically processing the monthly data For other substances...
- 66
- 195
- 2
Honda environmental annual report 2002 this report has been compiled forcusing on the environmental conservation activitieshonda undertook in japan in the fiscal 2001
... Commitments the items to be reported in this report, because it has become the objective to be achieved by the entire industry Honda is in the process of introducing environmental accounting based on the ... plans are established by the individual active departments on the basis of medium-term policies determined by the Executive Committee These plans are then discussed and approved at the Environmental ... activities at the observation wells established within the premises of the factories As a result, it is confirmed that harmful substances used at the factories have never been emitted beyond the boundaries...
- 63
- 386
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008