Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

Control of transferrin expression by b -amyloid through the CP2 transcription factor Sang-Min Jang 1, *, Jung-Woong Kim 1, *, Chul-Hong Kim 1 , Joo-Hee An 1 , Eun-Jin Kang 1 , Chul Geun Kim 2 , Hyun-Jung Kim 3 and Kyung-Hee Choi 1 1 Department of Life Science (BK21 Program), College of Natural Sciences, Chung-Ang University, Seoul, Korea 2 Department of Life Science and Research Institute for Natural Sciences, Hanyang University, Seoul, Korea 3 College of Pharmacy, Chung-Ang University, Seoul, Korea Introduction Alzheimer’s disease (AD) is a neurodegenerative dis- ease that affects cognition, behavior and function [1]. Two major protein aggregates are associated with AD, extracellular neuritic plaques (NP) and intracellular neurofibrillary tangles (NFT). b-amyloid peptides (Ab) are 40 and 42 amino acid peptides derived from the amyloid precursor protein by the action of b- and c-secretase, and are the major components of NPs [2]. NFTs are composed of the microtubule-associated protein tau, which is phosphorylated by kinases such as glycogen synthase kinase 3b (GSK3b), cAMP- dependent kinase, stress activated protein kinase (SAPK)4 ⁄ p38d and casein kinase 1 [3–5]. Hyper- phosphorylated tau forms toxic aggregates that pre- cede NFT formation [6,7]. These two aggregates induce neuronal death and synaptic loss during devel- opment of AD. Oxidative stress-related neuronal cell death has long been implicated in a number of age-associated diseases, including AD [8–10]. In many cases, the rate of oxygen Keywords Alzheimer’s disease; CP2; iron homeostasis; oxidative stress; transferrin Correspondence K H. Choi, Department of Life Science (BK21 Program), College of Natural Sciences, Chung-Ang University, 221 Heuksuk Dong, Dongjak Ku, Seoul 156-756, South Korea Fax: +82 2 824 7302 Tel: +82 2 820 5209 E-mail: khchoi@cau.ac.kr *These authors contributed equally to this work The authors declare no conflict of interest (Received 16 February 2010, revised 28 June 2010, accepted 12 July 2010) doi:10.1111/j.1742-4658.2010.07801.x Accumulation of b-amyloid protein (Ab) is one of the most important pathological features of Alzheimer’s disease. Although Ab induces neurode- generation in the cortex and hippocampus through several molecular mech- anisms, few studies have evaluated the modulation of transcription factors during Ab-induced neurotoxicity. Therefore, in this study, we investigated the transcriptional activity of transcription factor CP2 in neuronal damage mediated by Ab (Ab 1–42 and Ab 25–35 ). An unbiased motif search of the transferrin promoter region showed that CP2 binds to the transferrin pro- moter, an iron-regulating protein, and regulates transferrin transcription. Ectopic expression of CP2 led to increased transferrin expression at both the mRNA and protein levels, whereas knockdown of CP2 down-regulated transferrin mRNA and protein expression. Moreover, CP2 trans-activated transcription of a transferrin reporter gene. An electrophoretic mobility shift assay and a chromatin immunoprecipitation assay showed that CP2 binds to the transferrin promoter region. Furthermore, the binding affinity of CP2 to the transferrin promoter was regulated by Ab,asAb (Ab 1–42 and Ab 25–35 ) markedly increased the binding affinity of CP2 for the trans- ferrin promoter. Taken together, these results suggest that CP2 contributes to the pathogenesis of Alzheimer’s disease by inducing transferrin expres- sion via up-regulating its transcription. Abbreviations Ab, b-amyloid protein; AD, Alzheimer’s disease; AICD, amyloid precursor protein (APP) intra-cellular domain; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; GSK3b, glycogen synthase kinase 3b; GST, glutathion S-transferase; NFT, neurofibrillary tangle; NP, neuritic plaque; ROS, reactive oxygen species; shRNA, small hairpin RNA. 4054 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS radical production is directly related to damage to the elements of living cells, such as proteins, DNA and membranes [11–15]. The results of a previous study suggest that the effects of Ab accumulation induce the production of hyperreactive oxygen species (ROS) via production of free radicals [16]. Increased oxidative stress can promote both formation of Ab [17] and hyperphosphorylation of tau in a manner that is reminiscent of neurofibrillar tangles [18]. Among the many possible metabolic consequences of progressive Ab accumulation, altered ionic homeostasis, particu- larly excessive calcium entry into neurons, makes a strong contribution to selective neuronal dysfunction and death, based on studies of the effects of aggre- gated Ab in culture [19,20]. Iron is involved in the generation of ROS by cata- lyzing the production of OH • from hydrogen peroxide (H 2 O 2 ) via the Fenton reaction [21]. Hydroxyl radicals can damage DNA, proteins and lipids, and are believed to be responsible for much of the cellular and tissue injury associated with reperfusion disorders [22]. In cases of AD, redox-active iron is associated with NPs and NFTs through participation in in situ oxida- tion and catalysis of H 2 O 2 -dependent oxidation [23]. It is generally accepted that iron overload leads to axonal dystrophy and necrotic or apoptotic cell death [24]. In AD, alterations of iron regulatory proteins cause an abnormal distribution of iron in the brain. Transferrin is an iron regulatory protein that carries ferric iron from the plasma, lymph and cerebrospinal fluid to cells through the transferrin cycle [25]. It has been reported that transferrin is homogenously distributed around NPs, and is found in astrocytes in the cerebral cortical white matter of AD brain tissue [26]. Moreover, a strong immunoreactivity with the iron storage protein ferritin was observed in NPs in AD hippo- campuses [27]. CP2 is a transcription factor that belongs to the Drosophila grainyhead-like gene family, and has been found to stimulate transcription of the a-globin gene [28]. Although CP2 is expressed ubiquitously, it has specific regulatory functions in certain types of cells. In erythrocytes, CP2 regulates a-globin expression by binding to the CP2 binding motif CNRG-N 6 - CNR(G ⁄ C) in the a-globin promoter [29,30]. CP2 is also known to play pivotal roles in neural tissue development, and it has been suggested that a poly- morphism in the 3¢-untranslated region of the CP2 gene is associated with sporadic AD [31]. Moreover, it has been proposed that CP2 plays an important role in Down syndrome-related AD by regulating the expression of a trifunctional enzyme encoded by the glycinamide ribonucleotide synthetase ⁄ aminoimi- dazole ribonucleotide synthetase ⁄ glycinamide ribonu- cleotide transformylase gene, which is localized to chromosome 21q22.1 within the Down syndrome critical region [32,33]. However, the mechanisms of transcriptional regulation of CP2 that may play an important role in the pathology of AD have not yet been fully elucidated. In this study, we identified CP2 as a novel transcrip- tional factor that regulates transferrin expression in response to Ab. An unbiased motif search of transfer- rin promoter sequences revealed that the transferrin promoter has putative CP2 binding sequences; there- fore, the functional roles of CP2 in transferrin tran- scription were examined in vitro and in vivo. These findings identify a new molecular pathway through transcription factor CP2 by which Ab increases gene transcription associated with the pathology of AD. Results Conserved sequences of the transferrin promoter region contain CP2 binding sites The iron regulatory protein transferrin is involved in ROS production, which causes neurotoxicity in neuro- nal cells. We therefore investigated which transcription factors could regulate transcription of the transferrin gene. To identify conserved sequences in the transfer- rin promoter, we first aligned the DNA sequence of the human transferrin promoter from )600 to )1, in relation to the transcriptional start site, with the corre- sponding regions of the mouse, rat, cow and horse transferrin genes. Analysis using multiple sequence alignment programs revealed the presence of conserved sites at positions )179 to )1 in the transferrin pro- moter. We next searched for transcription factors that are likely to recognize a binding motif in the conserved transferrin promoter sequences. As shown in Fig. 1A, several transcription factors were identified as putative binding factors for transferrin promoter regions includ- ing CP2, specificity protein 1 and p53. Interestingly, we found that the CP2 binding site was the most fre- quent motif in the conserved transferrin promoter. Specifically, our analysis revealed that there are four CP2 consensus sites at positions )178 to )159, )130 to )113, )115 to )105 and )53 to )35 (Fig. 1B). Transcription factor CP2 increases the endogenous transferrin mRNA level To determine whether CP2 is a possible transcriptional regulator of transferrin, HEK293 cells were tran- siently transfected with CP2 expression plasmids, and S M. Jang et al. Regulation of transferrin expression by CP2 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4055 transferrin mRNA expression was analyzed by RT- PCR. As shown in Fig. 2A, over-expression of CP2 significantly up-regulated transferrin transcription in a concentration-dependent manner. Moreover, transfec- tion of CP2 small hairpin RNA (shRNA) that effec- tively decreased the level of exogenous FLAG-tagged CP2 proteins reduced the mRNA level of transferrin (Fig. 2A, lane 4). In addition, knockdown of endoge- nous CP2 using its shRNA significantly reduced trans- ferrin mRNA expression (Fig. 2B). Taken together, these results suggest that transcription of transferrin is dependent on CP2 expression. To further examine the functional roles of CP2 in transferrin transcription, promoter reporter assays were performed. The trans- ferrin promoter fragment from )600 to )1 was cloned, and reporter constructs were transiently transfected into HEK293 cells with CP2 expression plasmids. In the presence of exogenous CP2, transferrin promoter activity was stimulated to a level 6.2 times greater than that of the control, and increased in a CP2 dose- dependent manner (Fig. 2C). In addition, transferrin promoter activity decreased in HEK293 cells transfect- ed with CP2 shRNA. Moreover, knockdown of endog- enous CP2 protein reduced the level of transferrin reporter activation. These results indicate that CP2 is able to activate the transcription of transferrin. The transferrin proximal promoter contains a CP2-response element To determine the responding element for the CP2-med- iated expression of transferrin, we performed luciferase CCCGTTAACCTGACGCGTTTGTGTTCTCCAGTTTCTAACGCGGGTCGGCCGGGGGAGGGAGGCACGT-ATTTCCGCTCGCC CCCGTTAACCTGACGCGTTTGTGTTCTCCAGTTTCTAACGTGGGTCGGCCGGGGGAG GCACAT-ATTTCCCCTCGCCCGGTGTCCCTCCGCCACGTCTTCGCCCAGACAGACAT CCCGTTCGCCCGACGCGTTTGTGTTCCCCAGTTCCTAACA CCCGTTCGCCCATCGCGTTTGTGTCCTCCAGTTCCCAACACGAGACGGGAGGCCCGG CTCCTATTTCCCCGCGCCCCGCACCCCTCCGCCGTGTCTGCGGCTAGTCAGACACGAGCGG CACACT AACAGCACCATCACCTAAGGTACGCGTCAAGACAGGGTG TCGAGTCCTTTACTCCACTAGTAGTC-CCGTTCTTTCCTTCCCCC ACCTACGCCCCACTAA CACACACACACACCACCACCACAAACGGGACCACCACCTAAGGTACGCGTCAAGACAGGGTGTATAGTCCTTTACTCCACTGGTAGTC-CCGTTCTTTCCTTCCCCC ACCCACGTCCCGCTAA AAAACA ACCTAAGGTGGGTGCCCAGACAAGGTCTCCAGTCCTTTACTCCACTAGTCGGGGCCGCTCCTTACTTCCCCCT-CCCGACTCCCCTCTAA AACGCG ACCTAAGGTAGGTGCCTAGACAGGGTCTCGGGTCTTTTACTCCACTAGTCGGACCCGCTCCTTACTTCACCCT-CCCTACTTTCCGCTAA AcaC acctAAGGT G G C AGaca GGT Tc aGTC TTTACTCCACTaGT g CcG TC TT CTTCcCCC CC aC cCC CTAA GACACG ACC TGAGGAAGGTGAGCGCCCAGCAGAGGTCTCGAGTCTTTTACTCCACTAGTCACC-CTGCTCATTCCTTCCCCCCAACCCTCTCCCCGCTAA CCCGTT cC gaCGcGTTTGTGt CtCCAGTT CtAAC g g cgg gg g atttcc cgcc CCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGG GTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA Homo sapiens : Mus musculus : Rattus norvegicus : Bos taurus : Equus caballus : CP2 II CP2 III CP2 IV CP2 I +1 –35 –53 –94 –105–115 –113–130–159–178 –193 Enhancer region Negative region –3600 –3300 –1000 –620 Promoter region –125 +1 Homo sapiens : Mus musculus : Rattus norvegicus : Bos taurus : Equus caballus : TCCTCGGACTCGAGTCGCCCCGTCCTTCTCCCTCGTCGAGGAGGCACCCCCTGGAAACTCTCGGGTCCTCGTCCT AAAGCTCCCTGTGGACCACCCCTC GTTTTCCACGACTCAGACAGAAACTGGAACTCGGGTCGAACAAAGAGGACG TAGGAGGGGGTTTTCCC CGAAACGGACAGTAAGACGTCAAGATCACACCCCAGACCCGCGTCAAGAAAAGGGAGA GGTCGGAGCCTCAGAAGGAGACACCTGAC GCGTCTATCCTGACCACCGTGCCTGGTCGAGACGTCGGGACCTCAG TCCTCGTCTCGGGGGGCCGAGGGTCGGGCGGCATCGGC GAGGACCGTGGCTCGCTCGGCGCTACTGTTACCGACG TAACACGAAGTACAGGGAAGGGTAGTTGTAAAGACAC GACCTGAGGAAGGTGAGCGCCCAGCAGAGGTCTCGAGT CTTTTACTCCACTA GTCACCCTGCTCATTCCTTCCCCCCAACCCTCTCCCCGCTAACCCGTTGGGCCGACGTGTT TGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA p300 SP-1 AP-1 SRY Human TF Gene ID: 7018 A B NF-κB E2F GATA-1, GATA-3 MyoD, NKX-2.5 GATA-1, GATA-2 G ATA - 1 , G ATA - 2 Oct-1 p53 CP2 AP-4 p300 CP2 CP2 p53 CP2 AP-2 +1 Fig. 1. Highly conserved regions of the transferrin promoter containing putative CP2 binding motifs. (A) The highly conserved region of the human transferrin gene (gene ID 7018) promoter was analyzed using the MOTIF searching program (TRANSFAC database, http://motif.gen- ome.jp) to identify possible transcription factors. CP2 is the factor that appears most frequently. (B) The promoter sequences for human, mouse, rat, cow and horse transferrin genes were aligned using a ClustalW multiple sequencing alignment program. The conserved sequences of the transferrin promoter are indicated in gray or black according to the percentage conservation (100% black, 80% gray). Boxes indicate conserved CP2 sites (CP2 I, GGGGCAGTGAGGGGCGGTG; CP2 II, GGGCAAGCGGGAACCAGGT; CP2 III, ATCTGTTTATTTCTGGCCG; CP2 IV, CCCCAAACCAA) and their positions relative to the transcriptional start site of the human transferrin promoter are indicated. CP2 III and IV overlap by 2 bp. Regulation of transferrin expression by CP2 S M. Jang et al. 4056 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS reporter assays using various mutant forms of human transferrin promoter in HEK293 cells. To accomplish this, we used three mutants from which the following regions had been deleted: CP2 binding site I (mutant 1; mut1), CP2 binding site I, III and IV (mutant 2; mut2), and the entire CP2 binding site (mutant 3; mut3) (Fig. 3A). As the CP2 binding site III sequence overlaps with the CP2 binding site IV sequence by two base pairs, we deleted these portions concurrently (Fig. 3A). As expected, the wild-type (WT) promoter encompassing nucleotides )600 to )1 induced lucifer- ase reporter activity in a CP2 concentration-dependent manner, while CP2 shRNA significantly reduced this activity (Fig. 3B, lanes 1–4). However, the mut1, mut2 and mut3 promoter constructs abolished the luciferase activity under both the CP2 over-expressed and knock- down conditions (Fig. 3B, lanes 5–16). These findings suggest that the CP2 binding site I at positions )53 to )35 is responsible for the CP2-mediated transcriptional activation of human transferrin, and imply that CP2 binds to CP2 binding site I directly or through interaction with other transcription factors to enhance transferrin gene expression in cells. CP2 binds to the transferrin promoter in vitro and in vivo To confirm whether CP2 binds directly to CP2 bin- ding site I in the proximal promoter region of trans- ferrin, we performed an electrophoretic mobility shift assay (EMSA) using glutathion S-transferase (GST)- tagged recombinant CP2 protein. An oligonucleotide FLAG-CP2 : 1 AB CD 234 –+ ++ ++ –––+ TF GAPDH CP2 shRNA : 1234 mRNA ratio of TF/GAPDH 0.0 0.5 1.0 1.5 2.0 ** TF CP2 shRNA : – + GAPDH 12 mRNA ratio of TF/GAPDH 12 0.0 0.4 0.7 1.0 ** FLAG-CP2 β-tubulin FLAG-CP2 : –+ ++ ++ –––+ CP2 shRNA : Fold change 1234 0 2 4 6 8 10 TF-luc ** TF-luc CP2 shRNA : –+ Endo CP2 β-tubulin Fold change 12 0 0.5 1.0 ** Fig. 2. Transcription factor CP2 increases the endogenous transferrin mRNA level. (A) Total RNA from HEK293 cells transfected with plas- mids expressing FLAG-tagged CP2 and ⁄ or CP2 shRNA was analyzed by RT-PCR using transferrin- and GAPDH-specific primers. The level of GAPDH was used as a loading control. Representative images of agarose gels are shown (upper panels) and band intensity was measured. Normalized transferrin levels were calculated relative to GAPDH (bottom panel). (B) HEK293 cells were transiently transfected with CP2 shRNA. RNA was extracted, and RT-PCR analysis was performed as in (A). (C) Lysates from HEK293 cells transfected with increasing amounts of plasmids encoding CP2 DNA, transferrin promoter–luciferase or CP2 shRNA vectors were analyzed for luciferase activity. All data were normalized to b-galactosidase activity. Data are expressed as fold increases compared to the control (upper panel). The expression lev- els of proteins were assessed by immunoblotting (bottom panels). Expression of b-tubulin was included as a loading control. (D) HEK293 cells were co-transfected with transferrin promoter–luciferase and pCMV-b-galactosidase with/without CP2 shRNA. Luciferase activity was measured 48 h after transfection and normalized to b-galaosidase activity. The expression levels of proteins were assessed by immunoblot- ting using CP2 antibody. All data are representative of three independent experiments, and statistical significance was determined using Tukey’s post hoc test (**P < 0.01). S M. Jang et al. Regulation of transferrin expression by CP2 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4057 encompassing the consensus CP2 binding site I at posi- tions )63 to )24 of the human transferrin promoter was used as a probe for EMSA. As shown in Fig. 4A, addition of CP2 produced a slower-migrating DNA– protein complex in a dose-dependent manner (lanes 4 and 5), whereas the GST protein, used as a control, did not form a DNA–protein complex (lanes 2 and 3). The presence of CP2 in the protein–DNA complex was verified by adding CP2 antibody. Addition of the CP2 antibody supershifted a portion of the CP2 com- plex (lane 6), but use of IgG as a negative control did not alter the binding pattern (lane 7). The trans- ferrin probe–CP2 protein–CP2 antibody complex dis- appeared when cold transferrin probes were added as competitors (lane 8). To further confirm CP2 binding to the region of the transferrin promoter in vivo, we performed a chroma- tin immunoprecipitation assay (ChIP) in HT22 cells, a mouse hippocampal cell line, using CP2 antibody. Prior to the ChIP assay, we observed endogenous CP2 protein expression by Western analysis in HT22 cells (data not shown). Binding of CP2 to the transferrin promoter was examined by PCR using appropriate primers. Normal rabbit serum used as a negative control did not immunoprecipitate the transferrin pro- moter, whereas CP2 antibody precipitated a region of the transferrin promoter that contains the CP2 binding sequences (Fig. 4B). These results (Fig. 4A,B) clearly indicate that CP2 induces transferrin transcription by directly binding to the transferrin promoter. Ab induces transcriptional activity of CP2 by enhancing its binding affinity to the transferrin promoter It has been reported that Ab regulates the transcrip- tional activity of several classic transcription factors, including nuclear factor-jB and activator protein-1 [34,35]. These observations raise the possibility that Ab modulates the transcriptional activity of CP2. To determine whether the transcriptional activity of CP2 can be modulated by Ab, HT22 cells were transiently transfected with luciferase reporter plasmids containing the CP2-responsive element of the human transferrin TF promoter A B –600 +1 II III IV I –600 –600 –600 –600 II III IV I –1 II III IV –82 II –131 –188 Control –600 ~ –1 Mutant 1 –600 ~ –82 Mutant 2 –600 ~ –131 Mutant 3 –600 ~ –188 Fold change 0 2 4 6 8 10 12 14 FLAG-CP2 : CP2 shRNA : –––– –––+ –––+ –––+ –––+ TF-luc : WT mut 1 mut 2 mut 3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 FLAG-CP2 β-tubulin ** n.s. n.s. n.s. Fig. 3. The transferrin proximal promoter region contains a CP2 response element. (A) Transferrin promoter constructs used in transactiva- tion studies. Various mutants of human transferrin promoters were used, and are indicated as a mutant 1, mutant 2 and mutant 3. The method used for mutation of transferrin promoters is described in Experimental procedures. (B) Each of the constructs shown in (A) and pCMV-b-galactosidase were transiently transfected into the HEK293 cells, together with increasing amounts of plasmids encoding CP2 DNA or CP2 shRNA vectors. At 48 h after transfection, cells were lysed and subjected to luciferase assays. Data were normalized against b-galac- tosidase activity and are expressed as the relative luciferase units compared to the control. The level of CP2 expression in each group of cells was confirmed by Western blotting, an example of which is shown (bottom panel). Expression of b-tubulin was used as a loading control. All data are representative of three independent experiments, and statistical significance was determined using Tukey’s post hoc test (**P < 0.01; n.s., not significant). Regulation of transferrin expression by CP2 S M. Jang et al. 4058 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS promoter. Forty-eight hours after transfection, cells were treated with Ab (Ab 1–42 : 0, 50 and 100 nm;Ab 25–35 : 0, 5, 10 and 20 lm) for an additional 12 h. As shown in Fig. 5A, Ab 1–42 treatment increased the level of transferrin transcripts by up to 3.5-fold compared with the control (lane 1), while knockdown of CP2 reduced Ab-induced transferrin–luciferase activities (lanes 5 and 6). Ab 25–35 treatment also increased CP2- mediated luciferase activity 2–3.5-fold compared with the control (Fig. 5B, lanes 1–4). Ab-induced transfer- rin–luciferase activity was decreased by the knockdown of CP2 (Fig. 5B, lane 5). Moreover, immunoblot analysis demonstrated that transferrin protein levels were increased by Ab 1–42 and Ab 25–35 treatment, whereas knockdown of CP2 reduced the transferrin protein level (Fig. 5A,B, bottom panel). These findings indicate that Ab (Ab 1–42 or Ab 25–35 ) modulates either expression of CP2 or the binding affinity to its target gene. However, CP2 protein expression was not chan- ged by Ab treatment (Fig. 5A,B). Taken together, these findings suggest that Ab enhances the ability of CP2 to bind to the transferrin promoter. To determine whether Ab increases CP2 binding affinity to the transferrin promoter, HT22 cells were treated with Ab (100 nm Ab 1–42 or 20 lm Ab 25– 35 ) for 12 h, and ChIP was performed. CP2 binding to the transferrin promoter increased under Ab-treated conditions (Fig. 5C,D), and this increase was clearly related to the increased levels of transferrin transcripts. To further confirm the effects of Ab on CP2-dependent precipitation of the transferrin promoter, CP2 shRNA- transfected HT22 cells were incubated with Ab (Ab 1–42 and A b 25–35 ), and a ChIP assay was performed. Knockdown of CP2 reduced the amount of trans- ferrin promoter precipitated in the presence of Ab (Fig. 5C,D, lane 3). These results show that Ab mark- edly enhances the binding affinity of CP2 towards its target gene promoter. Discussion Mis-regulation of iron-related proteins changes iron homeostasis and causes ROS generation, which medi- ates neurodegenerative diseases. Transferrin is an iron- transporting protein that is involved in the storage and maintenance of iron homeostasis in living organisms. In case studies, transferrin was found to be signifi- cantly up-regulated in the AD frontal cortex compared with normal cases [36]. In the present study, we explored the molecular mechanisms by which CP2 reg- ulates transferrin expression in response to Ab.To identify possible transcription factors that can modu- late transferrin expression, we used a motif searching program and found several putative transcription fac- tors that can bind to the highly conserved transferrin promoter (Fig. 1A). Of these putative transcription factors, we selected CP2, because its binding sites appear most frequently on the transferrin promoter, suggesting that CP2 plays an important role in 12345678 GST (ng) : A B GST-CP2 (ng) : CP2 Ab : IgG : cold probe : – ––––– ––– 40 80 40 80808080 –––––+–– ––––––+– –––––––+ Free probe - shift - super shift - N.S. - Input IgG CP2 HT22 (TF promoter) Densitometric value 0.0 5.0 10.0 23 1 2 3 IP with: Fig. 4. CP2 is able to bind to the proximal transferrin promoter con- sensus element in vitro and in vivo. (A) An oligonucleotide probe covering a 19 bp CP2-dependent enhancer DNA segment of the transferrin promoter was used for CP2 binding by EMSA. GST- fused recombinant CP2 was purified from E. coli using GST beads. The CP2–DNA complex migrated slowly and the amount increased in a concentration-dependent manner (lanes 4 and 5). The exis- tence of CP2 in this slow-migrating complex was verified by adding CP2 antibody, which caused a supershift (lane 6). Rabbit IgG and non-labeled probe were included as negative controls (lanes 7 and 8). N.S., non-specifically bound probe. (B) Chromatin from mouse hippocampal cell line HT22 was cross-linked with endogenous CP2. After precipitation with antibody against CP2 and rabbit IgG, the transferrin promoter regions containing the CP2 element were amplified by PCR from the precipitated DNA (upper panel). The intensity of the transferrin promoter band was quantified by densitometry (bottom panel). S M. Jang et al. Regulation of transferrin expression by CP2 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4059 transferrin transcription. Indeed, ectopic expression or knockdown of CP2 modulated transferrin mRNA level and transferrin–luciferase activity (Fig. 2). In luciferase experiments using transferrin promoter deletion mutants, we found that the short sequence between positions )53 and )35 of the transferrin promoter region was the responding element (Fig. 3B). CP2 was able to bind to this site both in vitro and in vivo (Fig. 4A,B). Furthermore, in the presence of Ab (both Ab 1–42 and Ab 25–35 ), the binding affinity of CP2 to transferrin promoter was enhanced (Fig. 5C,D) and the transcriptional activity of CP2 to induce transferrin expression was also up-regulated (Fig. 5A,B). Although CP2 is necessary to regulate the expression of globins in erythrocytes, it has also been identified as a possible transcription factor that mediates enhanced transcription of the glycinamide ribonucleotide synthe- tase ⁄ aminoimidazole ribonucleotide synthetase ⁄ glycina- mide ribonucleotide transformylase gene, which increases the levels of oxidative stress markers such as de novo purine biosynthesis and production of hypo- xanthine and xanthine in Down syndrome-related AD [32,33]. GSK3b is also known as a transcrip- tional target of CP2 [37], and it has been reported that CP2 increases the level of GSK3b transcripts via binding to CP2 binding sites at positions )1to TF promoter Aβ 25–35 (20 mM) : CP2 shRNA : IP : CP2 Ab Input 123 –++ ––+ 123 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Fold increase ** TF-Luc 123456 0 1 2 3 4 5 AB CD 0 50 100 0 50 100 Aβ 1–42 (nM): CP2 shRNA : WB: anti-TF WB: anti-CP2 WB: anti-β-Tubulin –––+++ β-tubulin CP2 TF Fold increase WB : anti-CP2 WB : anti-β-Tubulin WB : anti-TF 1234 5 Aβ 25–35 (mM) : CP2 shRNA : 01020 20 ––––+ 1.00 1.49 1.46 2.12rel. TF : 0.18 Fold increase 0 1 2 3 4 TF-luc ** 5 β-tubulin CP2 TF ** ** n.s. IP : CP2 Ab Input TF promoter Aβ 1–42 (100 nM) : CP2 shRNA : 123 –++ ––+ 123 0.0 0.5 1.0 1.5 2.0 Fold increase ** Fig. 5. Treatment with Ab modulates the transcriptional activity of CP2 by enhancing its binding affinity to transferrin promoter. (A,B) Trans- ferrin reporter vectors and pCMV-b-galactosidase were transiently transfected into HT22 cells, with or without CP2 shRNA vectors. Forty- eight hours after transfection, cells were exposed to various concentrations of Ab 1–42 (50 or 100 nM) and Ab 25–35 (5, 10 and 20 lM) for 12 h, then luciferase activity was measured (upper panel). Data were normalized using b-galactosidase activity, and are expressed as the relative luciferase units compared to the control. Protein levels were verified by Western blotting using antibodies against transferrin, CP2 and b-tubulin (as a loading control) (bottom panels). The band intensity was measured, and transferrin protein levels were normalized relative to b-tubulin. (C,D) After transfection and Ab treatment in HT22 cells as described above, cells were cross-linked with 1% formaldehyde and chromatin immunoprecipitations were performed using the CP2 antibody or rabbit IgG as a negative control. Binding of CP2 to the transferrin was detected by performing PCR using primers to the highly conserved transferrin promoter site. The ChIP experiments were performed several times, and representative gel images are shown. The equivalent of 1% of the chromatin used for each ChIP assay was also run on each gel (left panels). After ChIP, the band intensity was measured and the normalized expression level under each condition was calculated relative to the input level (right panels). All data are representative of three independent experiments, and statistical significance was determined using Tukey’s post hoc test (**P < 0.01; n.s., not significant). Regulation of transferrin expression by CP2 S M. Jang et al. 4060 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS +10 in the GSK3b promoter [37]. Up-regulated GSK3b expression accelerates tau phosphorylation, which causes neuronal cell death by formation of NFTs. The level of transferrin was significantly up-regulated in the frontal cortex of AD patients com- pared with aged normal cases [36]. Although normal levels of transferrin protein are known to function as anti-oxidants, it is thought that up-regulation of trans- ferrin may cause problems associated with iron over- load, such as hyperferritinemia [38]. It has been reported that CP2 interacts with the intracellular domain of amyloid precursor protein (AICD). AICD consists of 50 or 59 amino acids, and is produced in the cytosol via the action of c-secretase during the amyloid precursor protein processing path- way. AICD is translocated to the nucleus through interaction with adaptor protein Fe65 [39], after which it acts as a co-activator by forming a ternary complex with Tip60 [40] or CP2 [39]. We observed an increase in transferrin mRNA expression when AICD protein was co-located with CP2 on the transferrin promoter (Fig. S1A,B). In addition, we found that CP2 modu- lates transferrin expression, with increased binding affinity to the transferrin promoter in the presence of Ab (both Ab 1–42 and Ab 25–35 ) (Fig. 5). However, it is still not clear how A b modulates the binding affinity of CP2. These findings raised the possibility that accu- mulation of Ab increases the intracellular ROS level [16], and that increased oxidative stress up-regulates the activity of c-secretase [41–43]. This may increase the production of AICD and result in up-regulation of the AICD–CP2 complex. Thus, we believe that increased production of AICD by Ab-related oxidative stress may stabilize the AICD–Fe65–CP2 ternary complex and increase the transferrin level by enhancing the transcriptional activity of CP2. The addition of Ab to CP2 shRNA-transfected HT22 cells resulted in increased cell viability (Fig. S1C), suggesting that the target genes of CP2 such as transferrin, GSK3b or gly- cinamide ribonucleotide synthetase ⁄ aminoimidazole ribonucleotide synthetase ⁄ glycinamide ribonucleotide transformylase may be involved in neurodegeneration or cell death. These results imply that CP2 plays an important role in Ab-mediated neurodegeneration. Despite intensive studies, there are few therapies available for AD. Accordingly, strategies including searching for and regulating factors that are involved in AD pathology and cell survival are required to improve treatment options. In the present study, we identified CP2 as a transcriptional mediator of trans- ferrin gene expression in response to Ab in HT22 cells. This is a newly discovered molecular mechanism by which AD may develop, and suggests a novel possibil- ity for AD treatment and prevention. Experimental procedures Cell culture and transfections Human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (Manassas, VA, USA). HEK293 and HT22 cells were maintained in Dulbecco’s modified Eagle’s medium supple- mented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) and penicillin–streptomycin (50 unitsÆmL )1 ). The b-amyloid peptides Ab 1–42 (A9810) and Ab 25–35 (A4559) were purchased from Sigma-Aldrich (St Louis, MO, USA). Transient transfection was performed using Lipofecta- mine 2000 (Invitrogen) with various plasmid DNAs accord- ing to the manufacturer’s instructions. Plasmid constructs Full-length CP2 was cloned into the FLAG expression vector. The human CP2 (hCP2) full-length coding region was ampli- fied from hCP2 cDNA in the human brain library (Clontech, Mountain View, CA) by PCR using primers 5¢-AAGCT TATGGCCTGGGCTCTG-3¢ and 5¢-GTCGACCTACT TCAGTATGAT-3¢, which contain HindIII and SalI sites, respectively. It was introduced into the pFLAG-CMV2 vector (Sigma-Aldrich), and the presence of the hCP2 clone was veri- fied by DNA sequencing. pGEX4T1-CP2 and CP2 shRNA were a gift from C.G. Kim (School of Life Sciences, Hanyang University, Seoul, Korea). Construction of reporter plasmids As the first step in generating the luciferase reporter con- structs, a human transferrin promoter sequence ()600 to )1) was generated by PCR using the human genomic DNA as a template and primers 5¢-AAGCTTAGGAGCC TGAGCTCA-3¢ (forward) and 5¢-AAGCTTAG CCTCCGGCGCCCC-3¢ (reverse). This PCR product was digested with HindIII, introduced into the pGL4.12 basic vector (Promega, Madison, WI) and verified by DNA sequencing. CP2 binding sequence deletion mutants of the transferrin promoter ()82 bp, TF-luc mut1; )131 bp, TF-luc mut2; )188 bp, TF-luc mut3) were prepared by PCR from the wild-type transferrin–luciferase construct (TF-luc WT) using the reverse oligonucleotide primers 5¢-AAGCTTAGCCGGGTTGCCCAA-3¢ (TF-luc mut1), 5¢-AAGCTTCCACTGATCACCTCA-3¢ (TF-luc mut2) and 5¢-AAGCTTGCACAGAAATGTTGA-3¢ (TF-luc mut3) and the forward primer given above for the TF-luc WT construct. The amplified promoter sequences were cloned into the HindIII sites of the pGL4.12 basic vector and then S M. Jang et al. Regulation of transferrin expression by CP2 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4061 verified by DNA sequencing using primer 5¢-CTAGCAA AATAGGCTGTCCC-3¢. Luciferase assay The HEK293 cells were cultured in 60 mm diameter dishes, and a total of 600–800 ng DNA including both the lucifer- ase reporter constructs and pCMV-b-galactosidase together with FLAG-tagged CP2 and ⁄ or CP2 shRNA was transfect- ed using Lipofectamine 2000. After 48 h of transfection, cells were lysed in reporter lysis buffer (Promega). The HT22 cells were cultured in 60 mm diameter dishes and transfected with the firefly luciferase transferrin reporter gene (0.1 lg) together with pCMV-b-galactosidase and ⁄ or CP2 shRNA. After 48 h of transfection, transfected HT22 cells were treated with Ab. Twelve hours after Ab treat- ment, cells were lysed in reporter lysis buffer. Cell extracts were analyzed with the luciferase reporter assay system using a Glomax luminometer (Promega). Luciferase activi- ties were normalized based on the b-galactosidase activity of the co-transfected vector. All transfection experiments were repeated at least three times independently. Western blotting For Western blot analysis, HEK293 and HT22 cells were harvested in cold phosphate-buffered saline and lysed in a buffer containing 1% Triton X-100, 150 mm NaCl, 50 mm Tris ⁄ HCl, pH 7.5, 0.1% SDS, 1% Nonidet P-40 (Sigma- Aldrich) and 1 mm phenylmethanesulfonyl fluoride. Total lysates were centrifuged at 10 000 g at 4 °C for 15 min, and the proteins were electrophoresed by 10% SDS ⁄ PAGE and transferred to a nitrocellulose membrane (Bio-Rad, Hercu- les, CA, USA). The membrane was blocked with 5% skim milk in a solution of 20 mm Tris ⁄ HCl (pH 7.6), 137 mm NaCl and 0.1% Tween-20, and incubated with appropriate dilutions of the primary antibody at room temperature for 3 h. Excess primary antibody was removed by sequential washing, and a 1 : 5000 dilution of the appropriate horse- radish peroxidase-conjugated secondary antibody was added to the membrane at room temperature for 1 h. The CP2 anti- body was kindly provided by C.G. Kim (School of Life Sci- ences, Hanyang University, Seoul, Korea). The monoclonal antibody against FLAG (F3165) was purchased from Sigma- Aldrich. Polyclonal antibodies against transferrin (sc-22597) and b-tubulin (sc-9104) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Western Blotting was visualized by chemiluminescence using an ECL system (Santa Cruz Biotechnology Inc.). RNA preparation and RT-PCR Total RNAs were extracted from HEK293 and HT22 cells using Trizol reagent (Invitrogen). The reverse transcription reaction was performed at 42 °C for 1 h in a total volume of 10 lL containing 800 ng RNA, 10 units of avian myelo- blastosis virus reverse transcriptase (Intron Biotechnology Inc., Seoul, Korea) and 100 pmol of oligo(dT) primers. The resulting cDNA was used as a template for PCR using 0.2 units of ExTaq according to the manufacturer’s recom- mendations (Takara Biotechnology Inc., Seoul, Korea). PCR conditions were as follows: denaturation at 95 °C for 3 min, followed by 30 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s and extension at 72 °C for 40 s, and concluding with a final extension at 72 °C for 10 min. The PCR products were separated on a 2% aga- rose gel and visualized by ethidium bromide staining. The primers used in PCR were 5¢-CCTGATCCATGGGCTA AGAA-3¢ (transferrin forward primer), 5¢-CGACCGGAA CAAACAAAAGT-3¢ (transferring reverse primer), 5¢-GA GTCAACGGATTTGGTCGT-3¢ (GAPDH forward pri- mer) and 5¢-TTGATTTTGGAGGGATCTCG-3¢ (GAPDH reverse primer). The expression level of GAPDH was used as an internal control. Electrophoretic mobility shift assays (EMSA) GST–CP2 fusion proteins and GST proteins were expressed in Escherichia coli strain BL21. Fusion proteins were puri- fied using glutathione–Sepharose (GE Healthcare, Piscata- way, NJ, USA), and their concentration was determined by the Bradford assay using Bio-Rad protein assay kit (Bio-Rad, CA, USA) according to the manufacturer’s instruction. Single-stranded complementary oligonucleotides were annealed and end-labeled with [c- 32 P]ATP using T4 polynucleotide kinase. The DNA sequences of the oligonu- cleotides corresponding to the conserved CP2 element in the proximal transferrin promoter at positions )63 to )24 are 5¢-TTATTCCATTCCCGGCCTGGGCGGGCTGGGC GCAATCTTT-3¢ (sense) and 5¢-AAAGATTGCGCCCAG CCCGCCCAGGCCGGGAATGGAATAA-3¢ (antisense). EMSA was performed with 40 or 80 ng of GST or GST- fused CP2 protein in binding buffer (100 mm Tris ⁄ HCl, pH 7.5, 10 mm EDTA, 1 m KCl, 1 mm dithiothreitol, 50% glycerol and 100 ngÆlL )1 BSA). For competition or supershift assays, the indicated unlabeled oligonucleotide competitor or CP2 antibody (2 lL) was added 30 min prior to addition of radiolabeled probe. After addition of the radiolabeled probe, the samples were incubated for 30 min at 30 °C and loaded on a 5% native polyacrylamide gel in 1 · Tris ⁄ acetate ⁄ EDTA (TAE) buffer, electrophoresed, dried and exposed to X-ray film. Chromatin immunoprecipitation (ChIP) ChIP was performed according to the instructions provided by Upstate Biotechnology, Inc. (Lake Placid, NY). Briefly, HT22 cells treated or untreated with 100 nm Ab 1–42 or 20 lm Ab 25–35 . Twelve hours after Ab treatment, cells were cross-linked with 1% formaldehyde in medium for 15 min Regulation of transferrin expression by CP2 S M. Jang et al. 4062 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS at 37 °C. Cells were then washed with ice-cold NaCl ⁄ P i and resuspended in 200 lL of SDS sample buffer containing a protease inhibitor mixture. The suspension was sonicated three times for 10 s each with a 1 min cooling period on ice, and 1% of each sample was retained as the input frac- tion. The chromatin solution was pre-cleared with 20 lLof protein A–agarose beads blocked with sonicated salmon sperm DNA for 30 min at 4 °C. The beads were removed, and the solution was immunoprecipitated overnight with 5 lg of the CP2 antibody at 4 °C, followed by incubation with 40 lL of protein A–agarose beads for an additional 1 h at 4 ° C. Normal rabbit IgG was used as a negative con- trol. The immune complexes were eluted with 100 lLof elution buffer (1% SDS and 0.1 m NaHCO 3 ), and formal- dehyde cross-links were reversed by heating at 65 °C for 6 h. Proteinase K was added to the reaction mixtures, which were incubated at 45 °C for 1 h. Immunoprecipitated DNA and control input DNA was purified using the phe- nol ⁄ chloroform extraction method, and then analyzed by semi-quantitative PCR using the human transferrin promoter-specific primers 5¢-CGCGATGACAATGGCTG CATTGTG-3¢ (forward) and 5¢-TGAGCAGCGAGCACA GTCGGACTC-3¢ (reverse). The PCR conditions were 95 °C for 3 min, then 98 °C for 10 s, 62 °C for 30 s and 72 °C for 50 s for 35 cycles. Statistical analysis Statistical analysis of variances between two experimental groups was performed using Tukey’s post hoc comparison test with Statistical Package for the Social Sciences (SPSS) version 11.5. All experiments were repeated at least three times. Differences are considered significant at P < 0.01. Acknowledgements This work was supported by the Mid-career Researcher Program through National Research Foun- dation of Korea grants funded by the Korean govern- ment (grant numbers 2009-0079913 and 2010-0000409). This work was supported by the Seoul R&BD Program (grant number 10543) and the BK21 Program. References 1 Albert MS (1996) Cognitive and neurobiologic markers of early Alzheimer disease. Proc Natl Acad Sci USA 93, 13547–13551. 2 Selkoe DJ (1999) Translating cell biology into therapeu- tic advances in Alzheimer’s disease. Nature 399, A23– A31. 3 Lovestone S, Reynolds CH, Latimer D, Davis DR, Anderton BH, Gallo JM, Hanger D, Mulot S, Marquardt B, Stabel S et al. (1994) Alzheimer’s disease-like phosphorylation of the microtubule- associated protein tau by glycogen synthase kinase-3 in transfected mammalian cells. Curr Biol 4, 1077– 1086. 4 Litersky JM & Johnson GV (1992) Phosphorylation by cAMP-dependent protein kinase inhibits the degrada- tion of tau by calpain. J Biol Chem 267, 1563–1568. 5 Feijoo C, Campbell DG, Jakes R, Goedert M & Cuenda A (2005) Evidence that phosphorylation of the microtubule-associated protein Tau by SAPK4 ⁄ p38delta at Thr50 promotes microtubule assembly. J Cell Sci 118, 397–408. 6 Anderton BH, Brion JP, Couck AM, Davis DR, Gallo JM, Hanger DP, Ladhani K, Latimer DA, Lewis C, Lovestone S et al. (1995) Modulation of PHF-like tau phosphorylation in cultured neurones and transfected cells. Neurobiol Aging 16 , 389–397. discussion 398–402. 7 Sperber BR, Leight S, Goedert M & Lee VM (1995) Glycogen synthase kinase-3b phosphorylates tau protein at multiple sites in intact cells. Neurosci Lett 197, 149–153. 8 Nunomura A, Perry G, Aliev G, Hirai K, Takeda A, Balraj EK, Jones PK, Ghanbari H, Wataya T, Shimohama S et al. (2001) Oxidative damage is the earliest event in Alzheimer disease. J Neuropathol Exp Neurol 60, 759–767. 9 Markesbery WR (1997) Oxidative stress hypothesis in Alzheimer’s disease. Free Radic Biol Med 23, 134–147. 10 Smith MA, Rottkamp CA, Nunomura A, Raina AK & Perry G (2000) Oxidative stress in Alzheimer’s disease. Biochim Biophys Acta 1502, 139–144. 11 Smith CD, Carney JM, Starke-Reed PE, Oliver CN, Stadtman ER, Floyd RA & Markesbery WR (1991) Excess brain protein oxidation and enzyme dysfunction in normal aging and in Alzheimer disease. Proc Natl Acad Sci USA 88, 10540–10543. 12 Smith MA, Richey Harris PL, Sayre LM, Beckman JS & Perry G (1997) Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J Neurosci 17, 2653– 2657. 13 Gabbita SP, Lovell MA & Markesbery WR (1998) Increased nuclear DNA oxidation in the brain in Alzheimer’s disease. J Neurochem 71, 2034–2040. 14 Barja G & Herrero A (2000) Oxidative damage to mito- chondrial DNA is inversely related to maximum life span in the heart and brain of mammals. FASEB J 14, 312–318. 15 Praprotnik D, Smith MA, Richey PL, Vinters HV & Perry G (1996) Plasma membrane fragility in dystrophic neurites in senile plaques of Alzheimer’s disease: an index of oxidative stress. Acta Neuropathol 91 , 1–5. 16 Behl C, Davis JB, Lesley R & Schubert D (1994) Hydrogen peroxide mediates amyloid b protein toxicity. Cell 77, 817–827. S M. Jang et al. Regulation of transferrin expression by CP2 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4063 [...]... differential modification of a-, b- and c-secretase expression Neurochem Int 55, 662–670 Supporting information The following supplementary material is available: Regulation of transferrin expression by CP2 Fig S1 Amyloid precursor protein (APP) involvement in CP2- mediated transcription Appendix S1 Cell viability assay This supplementary material can be found in the online version of this article Please... with the promoter of the murine a-globin gene Mol Cell Biol 8, 3215– 3226 29 Kim CG, Swendeman SL, Barnhart KM & Sheffery M (1990) Promoter elements and erythroid cell nuclear factors that regulate a-globin gene transcription in vitro Mol Cell Biol 10, 5958–5966 30 Lim LC, Fang L, Swendeman SL & Sheffery M (1993) Characterization of the molecularly cloned murine a-globin transcription factor CP2 J... Gaillac M et al (2000) The transcriptional factor LBP-1c ⁄ CP2 ⁄ LSF gene on chromosome 12 is a genetic 4064 32 33 34 35 36 37 38 39 40 41 determinant of Alzheimer’s disease Hum Mol Genet 9, 2275–2280 Aimi J, Qiu H, Williams J, Zalkin H & Dixon JE (1990) De novo purine nucleotide biosynthesis: cloning of human and avian cDNAs encoding the trifunctional glycinamide ribonucleotide synthetase-aminoimidazole...Regulation of transferrin expression by CP2 S.-M Jang et al 17 Misonou H, Morishima-Kawashima M & Ihara Y (2000) Oxidative stress induces intracellular accumulation of amyloid b-protein (Ab) in human neuroblastoma cells Biochemistry 39, 6951–6959 18 Blass JP, Baker AC, Ko L & Black RS (1990) Induction of Alzheimer antigens by an uncoupler of oxidative phosphorylation Arch Neurol... 6545–6550 Cao X & Sudhof TC (2001) A transcriptionally [correction of transcriptively] active complex of APP with Fe65 and histone acetyltransferase Tip60 Science 293, 115–120 Tamagno E, Guglielmotto M, Aragno M, Borghi R, Autelli R, Giliberto L, Muraca G, Danni O, Zhu X, Smith MA et al (2008) Oxidative stress activates a positive feedback between the c- and b-secretase cleavages of the b-amyloid precursor... synthetase-glycinamide ribonucleotide transformylase by functional complementation in E coli Nucleic Acids Res 18, 6665–6672 Banerjee D & Nandagopal K (2007) Potential interaction between the GARS-AIRS-GART gene and CP2 ⁄ LBP-1c ⁄ LSF transcription factor in Down syndrome-related Alzheimer disease Cell Mol Neurobiol 27, 1117–1126 Kaltschmidt B, Uherek M, Volk B, Baeuerle PA & Kaltschmidt C (1997) Transcription. .. oxidative phosphorylation Arch Neurol 47, 864–869 19 Lorenzo A & Yankner BA (1994) b-amyloid neurotoxicity requires fibril formation and is inhibited by Congo red Proc Natl Acad Sci USA 91, 12243–12247 20 Pike CJ, Burdick D, Walencewicz AJ, Glabe CG & Cotman CW (1993) Neurodegeneration induced by b-amyloid peptides in vitro: the role of peptide assembly state J Neurosci 13, 1676–1687 21 Wardman P & Candeias... Transcription factor NF-jB is activated in primary neurons by amyloid b peptides and in neurons surrounding early plaques from patients with Alzheimer disease Proc Natl Acad Sci USA 94, 2642– 2647 Vukic V, Callaghan D, Walker D, Lue LF, Liu QY, Couraud PO, Romero IA, Weksler B, Stanimirovic DB & Zhang W (2009) Expression of inflammatory genes induced by beta-amyloid peptides in human brain endothelial cells... histochemical study of iron, transferrin, and ferritin in Alzheimer’s diseased brains J Neurosci Res 31, 75–83 27 Grundke-Iqbal I, Fleming J, Tung YC, Lassmann H, Iqbal K & Joshi JG (1990) Ferritin is a component of the neuritic (senile) plaque in Alzheimer dementia Acta Neuropathol 81, 105–110 28 Barnhart KM, Kim CG, Banerji SS & Sheffery M (1988) Identification and characterization of multiple erythroid... 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS S.-M Jang et al 42 Shen C, Chen Y, Liu H, Zhang K, Zhang T, Lin A & Jing N (2008) Hydrogen peroxide promotes Ab production through JNK-dependent activation of c-secretase J Biol Chem 283, 17721–17730 43 Quiroz-Baez R, Rojas E & Arias C (2009) Oxidative stress promotes JNK-dependent amyloidogenic processing of normally expressed human APP by differential . to the transcriptional start site of the human transferrin promoter are indicated. CP2 III and IV overlap by 2 bp. Regulation of transferrin expression by. investigated the transcriptional activity of transcription factor CP2 in neuronal damage mediated by Ab (Ab 1–42 and Ab 25–35 ). An unbiased motif search of the transferrin