library functions and user defined functions in c
Stored Procedures, Triggers, and User-Defined Functions on DB2 Universal Database for iSeries doc
... FETCH c1 INTO proc_cusnbr, proc_cuscrd; WHILE at_end = DO 10 SET proc_cuscrd = proc_cuscrd +(proc_cuscrd * i_perinc); UPDATE ordapplib.customer 11 SET cuscrd = proc_cuscrd WHERE CURRENT OF c1 ; ... numrec = 0; fetch_loop: LOOP FETCH c1 INTO proc_cusnbr, proc_cuscrd; IF SQLCODE = THEN SET proc_cuscrd = proc_cuscrd * 1.2; UPDATE ordapplib.customer SET cuscrd = proc_cuscrd WHERE CURRENT OF c1 ; ... Procedures, Triggers, and User- Defined Functions on DB2 Universal Database for iSeries User- defined functions and user- defined table functions UDFs and user- defined table functions (UDTFs) are user- written...
- 594
- 3,044
- 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot
... independence by restricting itself to (a) a domain-independent linguistically-motivated phrase-structure g r a m m a r [6] a n d (b) and the domain-specific files produced by the knowledge acquisition ... domain-specific d/ctlon~ry file contains s o m e standard terms (articles, ordinals, etc.) and also both root words and inflections for terms acquired from the user The sample dictionary entry ( ... adjective "long", and m a y occur in n o u n phrases whose 'head n o u n refers to entities of type meeting or week By having this information in the dictionary, the parser can perform "local" compatibility...
- 5
- 452
- 0
Báo cáo khoa học: "User-Defined Nonmonotonicity in Unification-Based Formalisms" pptx
... nonmonotonic information to a nonmonotonic sort by calling a nonmonotonic definition as defined in the previous section The actual nonmonotonic rule occurring within the sort is a pair consisting of ... allow the user to define nonmonotonic constructions The main idea in their approach is that each node in a feature structure consists of a n o n m o n o t o n i c sort Such sorts can contain two ... order and nonmonotonic rules The constraints on classes are inherited through the hierarchy Every object in a class is assumed to contain at least the information given by the constraints specified...
- 7
- 279
- 0
Tài liệu Use Variables and Functions in T-SQL pptx
... (Double-click on the form to bring up the code.) Creating the T-SQL routine described in the "Technique" section, this code then assigns the routine to the Text property of the Label called lblSQLString ... Date() function, which is used in Visual Basic, in T-SQL, you use the GetDate() function Functions also will not necessarily return the same values or accept the same parameters This How-To calls ... Initialing Local Variables in T-SQL To initialize the variables, you will use the SET command, shown in these two lines of code: SET @Cust_Id = 'ANTON' SET @Order_Date = '11/27/1996' By setting...
- 4
- 548
- 0
Tài liệu User Defined Functions doc
... bày trư c chương trư c, bạn c hai (2) c ch để tạo UDFs: sử dụng c u lệnh T-SQL dùng tiện ích Enterprise Manager II.1.1 Sử dụng c u lệnh T-SQL Bạn c u lệnh CREATE FUNCTION để tạo UDFs c ch sử dụng ... ích SQL Query Analyzer sử dụng c ng c dạng dấu nh c lệnh (command-prompt) điển c ng c osql C pháp: CREATE FUNCTION [Tên_FUNCTION] (Khai báo tham số ) RETURNS Kiểu_dữ Liệu_trả_về AS BEGIN -C c ... vấn c u lệnh SELECT mệnh đề RETURN Không c phần thân hàm với vi c bắt đầu BEGIN kết th c END Mệnh đề RETURN chứa c u lệnh SELECT đơn giản nằm c p dấu ngo c đơn C u lệnh SELECT sử dụng hàm c ...
- 5
- 559
- 4
Tài liệu Executing SQL Server User-Defined Scalar Functions doc
... scalar function is a SQL routine that accepts one or more scalar input parameters and returns a single value A user- defined scalar function is invoked from a query or executed like a stored procedure ... File: ScalarFunctionForm.cs // Namespaces, variables, and constants using System; using System.Configuration; using System.Data; using System.Data.SqlClient; // String sqlText = "SELECT *, ... procedure using an EXECUTE statement You can invoke scalar functions where scalar expressions can be used To invoke a scalar function, use the following syntax: [databaseName.]ownerName.functionName([argument1][,...
- 2
- 299
- 1
Tài liệu Creating User-Defined Functions pdf
... 5.4000 and 18.0000: DECLARE @MyDiscountFactor float SET @MyDiscountFactor = 0.3 SELECT dbo.DiscountPrice(UnitPrice, @MyDiscountFactor), UnitPrice FROM Products WHERE ProductID = 1; Using Inline ... button on the User Defined Functions node in the Databases folder and selecting New User Defined Function You can then cut and paste the contents of DiscountPrice.sql into the Enterprise Manager ... running the script That way, the function is created in the Northwind database You can also create functions using Enterprise Manager You this by clicking the right mouse button on the User Defined...
- 7
- 274
- 0
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... oligonucleotide is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and enzymes were added as indicated in the figure legends, and incubated ... be important for plant cells On the other hand, the N-terminal BRCT domain proposed to mediate protein–protein interactions involved in DNA repair and cell cycle checkpoint regulation on DNA damage ... (2002) Characterization of plant proliferating cell nuclear antigen (PCNA) and flap endonuclease-1 (FEN-1), and their distribution in mitotic and meiotic cell cycles Plant J 28, 643–653 Uchiyama,...
- 9
- 492
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... PCR using the following primer pairs: AtRPA70a-5¢ (TGT AACCGAGATGGTCGGCAAC) and AtRPA70a-3¢ (AA CAGTCATCTTCACTCTTTGT); AtRPA70b-5¢ (TTCAA CTTTGTACCCATTGAT) and AtRPA70b-3¢ (TTCACCG CCATTATATACCTTA) ... ribosomal protein S16 (At5g18380) was used (5¢ primer: GGCGACTCAACCAGCTACTGA; 3¢ primer: CGGTAA CTCTTCTGGTAACGA) The three-step cycling conditions were: 29 PCR cycles for AtRPA70b (F1-R1), 35 cycles for ... transgenic lines were selected on MS agar medium containing kanamycin, rifampicin, and chloramphenicol Chlorophyll extraction The concentration of chlorophyll extracted in 80% acetone was determined...
- 12
- 588
- 0
Muscle Functions in Polymyalgia Rheumatica and Giant-Cell Arteritis docx
... is some evidence that mitochondrial functions may be deteriorated in muscle cells, leading to diminished production of energy-rich compounds in muscle cells and increased blood lactate,7 but it ... requently occur together, have unknown causes and have different clinical manifestations.1,2 Inflammatory processes both in vessels and in onnective c t issue can cause a wide variation of clinical ... mass, respectively Healthy Aging & Clinical Care in the Elderly 2010:2 Muscle functions in PMR and GCA Table Characteristics of polymyalgia rheumatica (PMR) patients by history of giant-cell arteritis...
- 8
- 265
- 0
Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot
... CGC CCC GC CC -3′ 6.4 GC CC AAAA CC CC CC -3′ 5.9 Rb: 5′- CC 5.8 3′ 5′ 3′ 3′ 5′ 5′ RET VEGF Class II N6/8 c- Myc: 5´- CCC Rb N2/5 CCC CACCTT CCC CA Bcl-2: 5´- CCC GCTCCCGC CCCC TTCCT CCC 3′ Transitional ... Journal compilation ª 2010 FEBS T A Brooks et al G-quadruplex and i-motif in oncogene promoters Class I N2 N3/4 Transitional pH N2 VEGF: 5′- CCC GC CCC CGG CCC GC CCC -3′ RET: 5′- CCC GC CC CGC CCC ... T A C C C C T C C C A C C C C T C C C A C C C C T T C C A C C C C T -5′ 5-base overhang 3′ 5′ Reduced reactivity to S1 nuclease and DMS G-quadruplex S1 (iv) S1 Reduced reactivity to KMnO4 and...
- 11
- 366
- 0
Báo cáo khoa học: Gene duplication and separation of functions in aB-crystallin from zebrafish (Danio rerio) pptx
... lens protein The spots containing both zebrafish aA-crystallin and aB1-crystallin, zebrafish aB2-crystallin and modifications or truncations of a-crystallins are indicated Molecular mass in kDa is ... understanding how lens crystallins became co-opted to produce transparent, refractive structures in the eye [36] Experimental procedures Cloning, sequencing and phylogenetic analysis A cDNA library ... 5¢-CCAACAGGGA CACGGTATTT-3¢ Cycle parameters were: 94 C for 15 s, 55 C for 30 s, and 72 C for Aliquots from each reaction were collected at 20, 25 and 30 cycles Preliminary reactions showed that 20 cycles...
- 10
- 372
- 0
Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx
... cellsurfaces and in TGN-labeled intracellular compartments: Previously, we characterized a series of carboxyl terminal truncations including the 204t and 211t encoding carboxyl terminal truncations ... virus-induced cell fusion Domain I is the largest domain (63 aa) and it includes stretches of acidic amino acid (D, E) clusters, which could form electrostatic interactions with other proteins ... secondary antibody [41] Specific immunofluorescence was examined using a Leica TCS SP2 laser scanning confocal microscope (Leica Microsystems, Exton, Pa.) fitted with a CS APO 63× Leica objective...
- 12
- 526
- 0
Báo cáo hóa học: "COINCIDENCE AND FIXED POINT THEOREMS FOR FUNCTIONS IN S-KKM CLASS ON GENERALIZED CONVEX SPACES" pot
... (3.6.3) and (3.6.3) Coincidence and fixed point theorems in S-KKM class (3.6.1) T is compact and closed (3.6.2) T(Y ) ⊆ s(X) + C (3.6.3) Y is closed and C is compact (3.6.3) Y is compact and C is closed ... [12] introduced the class U to be the one satisfying (a) U contains the class Ꮿ of (single-valued) continuous functions; (b) each T ∈ Uc is upper semicontinuous and compact-valued; and (c) for any ... point which is impossible by noting that T has no fixed point Consequently, T ∈ Uk (X,X), and hence we can not / c apply Theorem of Park [11] to conclude that T and H have a coincidence point Corollary...
- 9
- 272
- 0
Báo cáo toán học: "Parking functions, stack-sortable permutations, and spaces of paths in the Johnson graph" docx
... v(r)}↑ (as increasing sequences) for all r = 1, n, where, for a set S, S↑ is the sequence obtained by arranging the elements of S in increasing order the electronic journal of combinatorics 9(2) ... of preferences that allows every car to park, then αp,q is called a parking function; this is the case if and only if p q When cars are parked according to αp,q , car Ci occupies space qw(i) , ... is(w) = d (In the example considered at the beginning of the proof, w = (421365), the consecutive decreasing subsequences are (4, 2, 1), (3), and (6, 5) and an increasing subsequence of maximal...
- 11
- 311
- 0
Báo cáo toán học: "Grothendieck bialgebras, Partition lattices, and symmetric functions in noncommutative variables" doc
... forms an inverse system in the category of graded algebras Let NCSym be its inverse limit in this category We call NCSym the algebra of symmetric functions in an in nite number of non-commuting variables ... #R75 C (1n |1m )=A|B C D 13 The result follows then from the following equality µ (C, D) = C (1n |1m )=A|B C D µ (C, D) = A|B C D Induction and restriction define a graded product and coproduct on ... Thibon, Noncommutative symmetric functions IV: Quantum linear groups and Hecke algebras at q = 0, Journal of Algebraic Combinatorics (1997), 339–376 [16] I Macdonald, Symmetric Functions and Hall...
- 19
- 210
- 0
Báo cáo khoa học: "Comparative analysis of heart functions in micropigs and conventional pigs using echocardiography and radiography" docx
... yhpargoidracohcE fo yteicoS naciremA eht ot gnidrocca yhpargoidracohce edom-M gnisu derusaem erew serutcurts caidrac eht fo sessenkciht dna snoisnemid ehT gnicart cihpargoidracohce relppoD lartceps ... esolc ehT snosaer lareves rof gnignellahc yllacinhcet si giporcim a fo yhpargoidracohce cicarohtsnarT ]02,81[ gip a fo yhpargoidracohce cicarohtsnart fo stroper wef era ereht ,revewoH )ecneirepxe ... sthgilhgiH egnellahc tnatsnoc a si gnittes lacinilc a ni noitcnuf caidrac gnitaulave yletaruccA noissucsiD lortnoc sv 50.0 < 081.8 ± 04.85 071.5 ± 74.56 )lm( )ztlohcieT( noitcarf noitcejE 70.0 ± 38.0...
- 8
- 309
- 0
Báo cáo toán học: "Partitions, rooks, and symmetric functions in noncommuting variables" pdf
... proving this result in the current section, we will devote the next to putting an algebra structure on certain rook placements which is isomorphic to NCSym The final section contains some comments ... Sagan, B E A chromatic symmetric function in noncommuting variables J Algebraic Combin 13, (2001), 227–255 [6] Riordan, J An introduction to combinatorial analysis Dover Publications, Mineola NY, ... (2006), Research Paper 75, 19 pp (electronic) [3] Bergeron, N., Reutenauer, C. , Rosas, M., and Zabrocki, M Invariants and coinvariants of the symmetric groups in noncommuting variables Canad J Math...
- 7
- 286
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008