letter of resignation from a car dealership
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
... physicians, also had close relations to a healthcare professional (family or friend), hereafter labeled “closely related healthcare professionals” Trust in a closely related healthcare professional ... knowledgeable person On the other hand it seemed all could take advantage of the feeling of trust in a healthcare professional in the early part of a cancer trajectory If a participant did not have ... 21 participants with a range of characteristics including age (median age 63 (range 36–79)), marital status, place of residence and gynecological diagnosis (Table 1) All characteristics in Table...
- 11
- 695
- 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
... dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at mm phosphate At 121 Temperature effects on hibernator PFK allostery ... probably due to temperature alone Sensitivity to adenylates (ATP inhibition, AMP and ADP activation) was reduced when the enzyme was assayed at °C, a temperature characteristic of hibernation, as ... 37 °C was 7.2 The concentration of Mg.ATP was held at 0.5 mM All other assay conditions are detailed in the Materials and methods Data are means ± SEM, n ¼ separate determinations Temperature...
- 9
- 579
- 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... produce plasmids pSIB1-Cd and pSIB1 -a3 +Cd, respectively The sequences of the 5¢ PCR primers were 5¢-AGAGAGAA TTCATATGTCAGATTTGTTCAG-3¢ for N-domain+, 5¢CTGAAAACGCTAAGCATATGGGTATTACGA-3¢ for C-domain–, ... [14] from psychrophilic bacteria consist of a heat labile domain and a heat stable domain Bentahir et al [13] have proposed that a heat labile domain provides a sufficient flexibility around the active ... unfolding has been observed for cold-adapted a- amylase and family xylanase from an Antarctic bacterium [20,21] The apparent optimal temperatures of these proteins for enzymatic activities are much...
- 11
- 332
- 0
Báo cáo hóa học: " Kinematic analysis of the daily activity of drinking from a glass in a population with cervical spinal cord injury" potx
... cervical SCI Acknowledgements This work was part of a project financed by FISCAM (Fundación para la Investigación Sanitaria de Castilla-La Mancha, Spain) which does not have any commercial interest ... to the analysis and acquisition of the data AAE contributed to the analysis and acquisition of the data EPR contributed to the software development All authors read and approved the manuscript ... was completed satisfactorily, a static calibration recording was made Using the static calibration recording, we checked that each marker was visible to at least one of the scanning cameras at...
- 12
- 608
- 1
Báo cáo y học: " Relevance of JAK2V617F positivity to hematological diseases - survey of samples from a clinical genetics laboratory" docx
... Page of Table Results of JAK2V617F Tests Sample Types and Diagnosis Number of total samples Number of V617F+ samples Percentage of V617F+ samples Average ages of V617F- samples Average ages of ... Leukemia 2010, 24:1128-38 Shide K, Shimoda HK, Kumano T, Karube K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada ... cross-contaminations Lane 11 did not give a clear PCR product and was excluded from further analysis Samples and are JAK2V617F-positive, while all the rest are JAK2V617F-negative Zhao et al Journal of...
- 6
- 308
- 0
báo cáo khoa học: " Evidence-informed health policy 1 – Synthesis of findings from a multi-method study of organizations that support the use of research evidence" pptx
... questionnaire, interview guide, and case study data collection plan We also engaged one individual from each of Africa, Asia, Europe, and Latin America to provide a very detailed review of the draft ... innovative nally by the Appraisal of Guidelines, Research and Evaluation in Europe (AGREE) collaboration, adapted one version of the questionnaire for organizations producing CPGs and HTAs and another ... finding that many organizations producing CPGs or HTAs conducted a focused review of one particular organization that they then emulated or a broad review of a variety of organizational models;...
- 7
- 261
- 0
báo cáo khoa học: " Release kinetics of VEGF165 from a collagen matrix and structural matrix changes in a circulation model" pot
... 3D models as a reasonable amendment in craniofacial reconstruction that offers multiple advantages They facilitate surgical planning by demonstrating the anatomical characteristics of the tissue ... operated upon By adding a haptic sensation, this approach optimizes preoperative planning The surgeon achieves a better impression of the anatomical situation, the actual amount of bone and the ... of specialized software systems, application of this technique is limited to larger medical centers The disadvantages are additional costs for software and computers and the additional time needed...
- 4
- 273
- 0
báo cáo khoa học: " Release kinetics of VEGF165 from a collagen matrix and structural matrix changes in a circulation model" pptx
... The collagen matrix appears porose and knotty (Fig 6a and 6b) Page of Figure Collagen matrix, azan staining (100×): representative central area of pure collagen matrix With immuno-gold-labelling ... incubated for days As a sample, the total volume of buffer medium was extracted and analysed to avoid saturation of the buffer medium with free VEGF165 To differentiate between the initial degradation ... process of endochondral bone development and mediating bone vascularisation for normal differentiation of chondrocytes and osteoblasts An increase in VEGF is an indication of increased vascular permeability...
- 7
- 208
- 0
List of adjectives from a to z
... frugal fruitful full fumbling functional funny fussy fuzzy F fabulous failing faint fair faithful fake false familiar famous fancy fantastic far faraway far-flung far-off G fast fat fatal fatherly ... rural rusty S sad safe salty same sandy sane sarcastic sardonic satisfied scaly scarce scared scary scented scholarly scientific scornful scratchy scrawny second secondary second-hand separate ... quintessential quirky quixotic quizzical R radiant ragged rapid rare rash raw recent reckless rectangular ready real realistic reasonable red reflecting regal regular reliable relieved remarkable remorseful...
- 7
- 433
- 0
Đơn xin nghỉ việc bằng tiếng Anh - Letter of Resignation
... Friday, January 25th Today I want to take the opportunity to thank you all for being a great team to work with all these years It has been an amazing working with you all these last three years and ... Goodbye letter from manager to his/her Team Dear Team, As I informed you all in the last meeting, I am moving on to a new challenging position in another company next week My last working day is ... each one of you Even though I will miss you all here I am looking forward to this new challenge and to start a new phase of my career This is not a goodbye, only “hasta luego” or “see you later”...
- 3
- 1,441
- 1
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... medical-waste-recycling-products The community awareness of the danger of medical wastes should be raised through various ways, ranging from propaganda, education and dissemination of information ... – Biofast – a kind of machine for filtering liquid wastes Biofast are outstanding because of its effectiveness and efficiency Biofast operates automatically; therefore, it reduces the man-made...
- 10
- 722
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International ... diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients ... effects of radiofrequency ablation versus medical therapy on the quality -of- life and exercise capacity in patients with accessory pathway-mediated supraventricular tachycardia: a treatment comparison...
- 9
- 679
- 0
Evaluation of Nutrient Loads from a Citrus Orchard in Japan
... showed that the Case evaluation gave a higher discharge than in Case Kunimatsu et al (2006) calculated cv (coefficient of variation) values of the annual loads in Mano River (watershed area of 16.4 ... station by Japan Meteorological Agency (2008) Load Estimations Load evaluation of Case was calculated by water discharge and nutrient load from our only weekly research data (Table 1) In the Case ... of TP was avoided in this study Evaluation of phosphorus loads will require the establishment of a seasonally separated equation model that takes into account rainfall events and seasonal changes...
- 10
- 425
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...
- 9
- 522
- 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation tunnel In the last ... until the air reaches its saturated state, when the air and water temperature reach the same value, called “adiabatic saturation temperature”, being the process known as “adiabatic saturation” To ... if air looses enthalpy, water would be heated Thus, in a process where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic...
- 28
- 652
- 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
... also fear of potential hazards of explosion, asphyxiation and toxicity from methane, carbon dioxide, and volatile organic compounds respectively The generation of methane and carbon dioxide from ... this paper, the concentration of NMOC, the average annual acceptance rate, and the age of the landfill were analyzed using Monte Carlo simulation This is because, t heir actual values are not ... mean, variance, and standard deviation are 60 years, 0.0496, and 0.223 respectively Figure Graph of the frequency against the range of values of CNMOC Figure Graph of frequency against range of...
- 8
- 540
- 0
Sockets and Services from a Security Point of View
... mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration information ... paying attention to details like available hard disk space, network bandwidth, and so on Install a server−based virus scanner to sanitize e−mail attachments as well Security characteristics of ... these can adversely affect network performance or crash the mail server when large amounts of mail are being processed Also, the lack of sender authorization leaves SMTP open to spam attacks and...
- 21
- 587
- 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... proclaim state years of sabbatical years of rest ultimate/ eventual final attain reach persistent constant swift fast anew again edifice of character set of character thereof of it, whose Table ... 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining solemnity as well as the leadership of the speaker Here is an account of the most notable ... indicates the evaluation of the speaker toward the truth or probability of a representation of reality From that base, we have an account of the two types of modality in the speech and times of...
- 44
- 578
- 0
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc
... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora, ... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... 0.25 µm) The analytical condition were the same as described above with He as carrier gas, and interface temperature 260o C Components identification was carried out by comparing MS data with those...
- 4
- 403
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008