legendre series expansion of a function
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization of a series of respiration-deficient ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit...
- 9
- 622
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, ... the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of 0.3 ... The level of functional enzyme refers to XDH species containing a functional Mo catalytic center The functionality is estimated as a ratio of change in the absorbance at 450 nm after anaerobic...
- 11
- 584
- 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc
... blot analysis of cytosolic sample probed with anti-(rat liver DPP III) that allowed the detection of both bands at 82 and 86 kDa anchorage of D melanogaster DPP III By comparison, the analysis of ... (Matsumoto Dental University, Nagano, Japan) The anti-(rat liver DPP III) was prepared as described by Fukasawa et al [2] Goat anti-rabbit Ig with peroxidase labelling was from Boehringer-Mannheim The ... SDS/PAGE analysis of fractions containing partially purified DPP activitiy revealed two major bands in the range of 82 and 86 kDa in both cytosolic and membrane samples (Fig 5) Western blot analysis...
- 9
- 357
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... pnas.27.4.222 Bae, J-H, Park, W-G: On stability of a functional equation with n variables Nonlinear Anal TMA 64, 856–868 (2006) doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation ... Bae and Park Journal of Inequalities and Applications 2011, 2011:82 http://www.journalofinequalitiesandapplications.com/content/2011/1/82 Page of for all x, y, z, w Î X Thus, the mapping F satisfies...
- 7
- 429
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... (2002) Kenary, HA: The probabilistic stability of a Pexiderial functional equation in random normed spaces Rend Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, ... details Department of Mathematics, College of Sciences, Yasouj University, Yasouj 75914-353, Iran 2Department of Mathematics, University of Ulsan, Ulsan 680-749, Korea 3Department of Mathematics, ... |r| + |s| A field K is called a valued field if K carries a valuation The usual absolute values of ℝ and ℂ are examples of valuations In 1897, Hensel [14] has introduced a normed space which...
- 14
- 479
- 0
Báo cáo hóa học: " Research Article Monotonic and Logarithmically Convex Properties of a Function Involving Gamma Functions" pdf
... Analysis, Cambridge Mathematical Library, Cambridge University Press, Cambridge, UK, 1996 B.-N Guo and F Qi, “Inequalities and monotonicity for the ratio of gamma functions,” Taiwanese Journal ... Differential- und Integralrechnung II, VEB Deutscher Verlag der Wissenschaften, Berlin, Germany, 1966 M Abramowitz and I A Stegun, Handbook of Mathematical Functions with Formulas, Graphs, and Mathematical ... inequality,” Tamkang Journal of Mathematics, vol 31, no 2, pp 145–148, 2000 F Qi and J.-S Sun, A mononotonicity result of a function involving the gamma function, ” Analysis Mathematica, vol 32,...
- 13
- 272
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, ... point approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol 1, no 2, pp 148–153, 2007 14 S.-M Jung and J M Rassias, “Stability of general Newton...
- 7
- 257
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
- 3
- 216
- 0
Báo cáo y học: " Presence of a functional but dispensable Nuclear Export Signal in the HTLV-2 Tax protein" pdf
... both Tax1 and Tax2, but amino acids 90 to 100 are also critical for the localization of the viral transactivators [16] Using prediction software as well as in vitro assays, we now describe another ... export via the CRM1 pathway, and that point mutations at positions 195 and 200 abrogate NES mediated translocation All in all, these results demonstrate that the NES sequences of Tax1 and Tax2 have ... using a Zeiss Axiocam HRc (color) camera and the Zeiss Apotome software Images of cells that are representative of the entire population are shown (C and E): Western-blot analysis of GFP and GFP-NES...
- 11
- 242
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5
... Hirakawa, H., Ohshima, K., Yamashita, A. , Shiba, T., Ogasawara, N., Hattori, M., Kuhara, S., and Hayashi, H (2002) Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater ... Rubie, E A. , Ahmad, M F., Avruch, J., and Woodgett, J R (1994) The stress-activated protein kinase subfamily of c-Jun kinases Nature 369, 156-160 Lachumanan, R., Armugam, A. , Durairaj, P., Gopalakrishnakone, ... Kotiranta, A. , Lounatmaa, K., Kari, E., Kerusuo, E., and Haapasalo, M (1997) Function of the Slayer of some Gram-positive bacteria in phagocytosis FEMS Microbiol Rev 20, 110-114 Krivan, H C., Clark,...
- 63
- 401
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 4
... 5. 5A) ; the cleavage of NAD by H-bond formation of the nicotinamide carboxyamide and the amide (NO1) and carbonyl group of Arg296 with the NN7 if nicotinamide followed by spontaneous withdrawal of ... components of signal transduction pathways, is a promising pharmacologic agent that can be utilized for physiological research at the cellular to organ level It may also be tapped as an anti-tumor drug ... ligand in colonic lysate whose influence was dissipated at higher ABP concentration To test our hypothesis, analytical grade muscle actin was used as substrate in photolabeling assay αactinin and...
- 25
- 212
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 3
... CAGTTGTTATTTTGTACTGACATATCATATAAATACATATTTT -117 -35 -10 TATGATATATAGTTACATATTTTATGAAATTTATATAAAAAAT -74 TCTTATTTAGATTATATAATCTAAATAAATTAAAGTTCAAGAG -31 -35 -10 Start cdtA +1 TTAATTAAACTAATATTGGGAGGGAGAATAAATGAAAAAATTT ... TTAATTAAACTAATATTGGGAGGGAGAATAAATGAAAAAATTT 12 AGGAAACAT TGATGCAACATTGA 1383 Stop TACCTTAA tattttttcacataaataatttaatatttttcaa Start cdtB atttaaggAGGAGAaaca ATGAAAATACAAATGAGGAATAAA 24 Figure 3.4 Characteristic features of 20309 ... Ia botA Ttgaca* Ttgaca* Ttgaca* TTGTTA TATAAT TTAACA TTTACA TTTACA TTAGCA TTTACA TATGTC TTTACA TGCACA TTGTCAT TTAACC TATAAT TATAAT TAtAAT* TATAAA TTCAAG TTATCT CTCCTT GTCTTT TATAGT TTATTC TATTTT...
- 52
- 186
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 2
... cdb8 GGAGATCCAAATCAGCCTAAAAC F 32-3954 AF271719 Rcda-For GAAGCAGAAAGAATAGAG F 217-234 AF271719 Rcda-Rev ATTAGGTAACAAACCCTCA R 1609-1591 AF271719 Rcdb-For GTGGGAAGATAGTTTTGC F 732-749 AF271719 ... 1010-1031 AF271719 CDTaY344-Rev TACAGTTAAATTAGTTGGAATAGGTTCACG R 1017-1000 AF271719 CDTaR345-For CAACTAATTTAACTGTATAT(GC)(CT)AAGATCTGCTCC F 1013-1034 AF271719 CDTaR345-Rev ATATACAGTTAAATTAGTTGGAATAGGTTC ... CCCCAAGCTTATATTAAGGTATCAA R 1085-1061 L76081 Ecdb-F2 CGCCTGCAGATGAAAATACAAATG F 1591-1641 L76081 Ecdb-R2 GGGCTGCAGTACTAATCAACACTA R 3351-3328 L76081 CDTaY344-For TTCCAACTAATTTAACTGTA(GCA)ATAGAAGATCTGC...
- 61
- 289
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 1
... drawing of SN1-type mechanism for Ia 130 x List of Abbreviations AAD antibiotic-associated diarrhea ADP adenosine diphosphate ATP adenosine triphosphate ADPRT ADP-ribosyltransferase ARTase ... ADP-ribosyltransferase assay (ARTase), analyses of wild-type and mutant CDTa activities revealed conserved amino acid residues that are crucial for its ability to hydrolyze cofactor nicotinamide adenine ... way to help Allow me to also extend a heartfelt gratitude to my labmates who have made my stay bearable, particularly to Gan Bong Hwa whom I have learned to consider as my little sister primarily...
- 13
- 244
- 0
the meaning and structure of a narrative a systemic functional analysis
... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis ... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...
- 39
- 826
- 2
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch
... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such ... hostname, access, and command mode passwords, as well as the management LAN settings These values are shown in the chart If problems occur while performing this configuration, refer to the Basic ... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright 2003, Cisco Systems, Inc Erasing...
- 4
- 337
- 0
Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc
... Inc Erasing and Reloading the Switch For the majority of the labs in CCNA and CCNA it is necessary to start with an unconfigured switch Use of a switch with an existing configuration may produce ... startup configuration from NVRAM #delete nvram This command resets the switch with factory defaults All system parameters will revert to their default factory settings All static and dynamic addresses ... be: Erase of nvram: complete Check that VLAN information was deleted Verify that the VLAN configuration was deleted in Step using the show vlan command If previous VLAN configuration information...
- 5
- 335
- 0
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
- 18
- 712
- 4
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc
... 355 banks are sorted into the five quintiles based on their average value of the repricing/maturity gap (see text for details) a As a share of total assets b As a share of total loans c As a share ... , A which we assume is constant over time and across banks Rather than make an arbitrary assumption about its value, we will give the data a chance to inform us about it and treat mOTH as a parameter ... Median Bank Balance Sheet Characteristics (By Repricing/Maturity Gap Quintile) Variable Total loansa Commercial & industrial loansb Commercial real estate loansb Residential real estate loansb...
- 47
- 528
- 1
Tài liệu Báo cáo khoa học: A functional polymorphism of apolipoprotein C1 detected by mass spectrometry docx
... ethnic background of at least 1000 subjects was typical of the American Midwest with 90% of European ancestry and 5% each of African and Asian ancestry An exception was the targeted analysis of ... sum of peaks of ApoC1 was determined for fraction and assigned a value of 1.0 The peak ratios in subsequent fractions are expressed relative to that value Also shown are the relative ratios of ... variants of ApoC1 A functional importance of a methyl group side chain at position 45 was also suggested by homology alignment ApoC1 from six available species shows either Ala or Thr at the comparable...
- 9
- 529
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008