Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 2

Chapter Review of Literature 1.1. Clostridium difficile Clostridium difficile is a spore-forming gram-positive bacilli. The organism was first referred to as “the difficult Clostridium” in 1935 because of its fastidious and slow growth in culture (Hall and O'Toole 1935). C. difficile produces an array of acid fermentation products which can be detected by gas-liquid chromatography (Hill, Osterhaut et al. 1988). Its isolation from stool specimen is significantly enhanced in selective agar medium supplemented with cefoxitin, cycloserine, fructose and egg yolk called cycloserine-cefoxitin fructose agar (CCFA). C. difficile produces the volatile fatty acid isocaproic acid, the tyrosine metabolic by-product pcresol and a yellow fluorescence on blood containing media (Bongaerts and Lyerly 1997). The organism has been isolated from a variety of sources including humans especially in the hospital setting, farmyard, domestic animals, soil sites, swimming pool and tap water samples (Al Saif and Brazier 1996; Wilcox, Cunniffe et al. 1996). Subterminal spore formation which makes this organism persistent and difficult to eradicate can be stimulated by sodium cholate and sodium taurocholate for improved recovery from clinical specimen. Resistant spores survive in adverse conditions, hence serving as the vector by which the infection is spread by food handlers or healthcare personnel (Samore, Venkataraman et al. 1996). This explains why hospitalized elderlies and neonates become colonized with this bacterium. The pathogen can cause a spectrum of disease symptoms ranging from mild self-limited diarrhea called C. difficile associated diarrhea (CDAD) to the formation of pseudomembrane leading to severe colitis called pseudomembranous colitis (PMC) and toxic megacolon (Kelly, Pothoulakis et al. 1994). PMC was first described in 1893 as diphtheritic colitis and it was not until the 1970s that C. difficile was implicated as the etiologic agent (Tedesco, Stanley et al. 1974a; Larson, Parry et al. 1977; Larson, Price et al. 1978). PMC was earlier thought to be caused by viral infection or mucosal ischemia until it was realized that stool specimen from patients contained a toxigenic factor with cytopathic effect in tissue culture cells (Larson, Parry et al. 1977). Afterwhich, C. difficile was identified as the source of the cytotoxin (Bartlett, Chang et al. 1978; Larson, Price et al. 1978), followed by reports on effective therapy using vancomycin (Keighley, Burdon et al. 1978; Tedesco, Markham et al. 1978). 1.2. Diagnosis Although colonoscopy or sigmoidoscopy have been useful as diagnostic tools for colitis, these techniques must be used judiciously due to the invasiveness of procedure (Hurley and Nguyen 2002). The “gold standard” for diagnosis of C. difficile infection is the cytotoxicity assay which detects toxin B. The test has 94% to 100% sensitivity and 97% specificity (Bond, Payne et al. 1995; Bartlett 1998). However, it requires a tissue culture facility and 1-2 days to complete. It should also be noted that toxin B is heat-labile, therefore, the shortest transport time and refrigeration of specimen is imperative so as to minimize proteolytic degradation of the toxin. Growth of C. difficile in egg yolk-enriched CCFA medium is a good adjunct but less specific than the cytotoxin assay. Positive assay results have been confounded by significant proportion of asymptomatic hospitalized patients who are colonized with C. difficile (George, Sutter et al. 1979). Rapid toxin testing methods can generate results within few hours, however, sensitivity is lower than the cytotoxicity assay at 85% with specificity at 100%. Enzyme-linked immunosorbent assay (ELISA) is the most widely used method in clinical setting (Knoop, Owen et al. 1993; Lyerly and Wilkins 1995; Brazier 1998). Another test which uses latex particle agglunation (LPA) detects glutamate dehydrogenase produced by C. difficile (Lyerly, Barroso et al. 1991). Caution should be observed however when interpreting LPA results because glutamate dehydrogenase produced by other anaerobes including Clostridium sporogenes, certain types of Clostridium botulinum and Peptostreptococcus anaerobius can cross react with antibody against the enzyme. Recently, Alfa et al. (2002), compared various diagnostic methods and found that cell culture cytotoxin detection is most specific and the Triage C. difficile test (TCT) as a more sensitive rapid screening test than ELISA. TCT detects toxin A and glutamate dehydrogenase surface antigen directly from stool samples within the day of receipt. This is the reason why cytotoxin test is recommended only for stools that required further testing. Another rapid diagnostic test that is comparable to ELISA involves the use of polymerase chain reaction (PCR) with 96% sensitivity and 100% specificity. Although primarily adopted in research settings, its application in clinical diagnosis has become popular. 1.3. Epidemiology Clostridium difficile is the most frequently implicated cause of antibiotic-associated diarrhea (AAD) and colitis (Frost, Craun et al. 1998; Djuretic, Wall et al. 1999). In the U.S., C. difficile infection is estimated at million cases of diarrhea and colitis annually. Most cases are nosocomially acquired with only about 20,000 diagnosed from outpatient setting (Kelly and LaMont 1998). However, public incidence maybe underestimated as community-acquired diarrhea is not routinely investigated for the presence of C. difficile or its toxin (Riley, Cooper et al. 1995). As disease incidence has been increasingly reported especially in healthcare facilities for the elders and large medical centers, C. difficile is now recognized as a major cause of nosocomial diarrhea in industrialized countries (Lyerly 1993). Approximately 15%-25% of hospitalized adults and debilitated patients carry the organism particularly those receiving chemotheraphy prior to surgery (Thomas, Bennett et al. 1990; Privitera, Scarpellini et al. 1991; Zimmerman 1991; Yassin, Young-Fadok et al. 2001). CDAD incidence in ambulatory adults has been estimated at to 12 cases per 100,000 personyears and up to 50% among infants and children (Bacon, Fekety et al. 1988; Hirschhorn, Trnka et al. 1994; Levy, Stergachis et al. 2000). The resistance of infants to C. difficile infection may provide some answers to the discovery of new treatment and information on pathogenesis of the organism (Lyerly and Wilkins 1995). Toxigenic strain is carried by 50% of asymptomatic infants with the protective mechanism involved still unclear (Lyerly and Wilkins 1995). Some argue that infants usually carry the weakly toxigenic strains belonging to serogroup F. These strains have toxin A-/B+ phenotype, produce lower levels of toxin and not typically associated with adult disease. Another proposed explanation is the immaturity of toxin receptors on infant enterocyte membrane (Eglow, Pothoulakis et al. 1992). Some research findings suggest that immunity against C. difficile toxins may prove to be an effective means of preventing infection. Kelly et al. (1992), reported that most adults secrete anti-toxin A IgA antibody into the colonic lumen that could block toxin binding with intestinal surface receptors. Furthermore, IgG antibody has been detected in about 60% of children and adults in the U.S., implicating possible humoral immunity (Viscidi, Laughon et al. 1983). This is supported by experimental results showing children with recurrent CDAD have lower serum levels of anti-toxin A IgG than age-matched controls. Moreso, those with inadequate humoral immune response were more predisposed to relapse (Leung, Kelly et al. 1991). 1.4. Pathogenesis The development of CDAD is dependent on several factors (Fig. 1.1). The first factor is acquisition of bacteria (Kelly and LaMont 1998). Since most patients become colonized during hospital or nursing home stay and develop asymptomatic sequelae, colonization of the colon is not sufficient for the development of disease. Instead, previous or concurrent antibiotic therapy is the aggravating factor. The organism competes with normal intestinal flora when the latter is disturbed by antibiotics which leads to overgrowth of C. difficile and elaboration of toxins. There is a strong association between clindamycin use and development of CDAD (Tedesco, Barton et al. 1974b) while broad-spectrum penicillins and cephalosporins are most commonly implicated because of their widespread use (Nolan, Kelly et al. 1987). Studies involving molecular typing reported that virulent C. difficile strains produce asymptomatic colonization more often than High number of non-spore forming anaerobe over Normal Gut Flora Antibiotic Therapy Cessation of treatment Relapse 10-20% Microflora alteration C. difficile proliferates Symptoms Abate Death Asymptomatic Vancomycin/ Metronidazole Release of Toxins A and B Ulceration of Colon CDAD Figure 1.1. Development and possible outcomes of C. difficile infection. Modified from Abigail A. Salyers and Dixie D. Whitt, “Bacterial pathogenesis a molecular approach, 2nd edition (2002)”. CDAD (Johnson, Clabots et al. 1990; Shim, Johnson et al. 1998), suggesting that extrinsic bacterial factors like host immunity and timing and dosage of antimicrobial exposure must be involved (Johnson and Gerding 1998). As C. difficile grows, the toxins are released upon autolysis then enter the host cell via receptor-mediated endocytosis and generalized pinocytosis. In rabbit, glycoprotein receptors for toxin A on enterocyte membrane were found to be linked to nucleotide regulatory protein (Pothoulakis, La Mont et al. 1991). Toxin A is an enterotoxin that causes excretion of fluid from bowel whereas toxin B is primarily cytotoxic causing disruption in the signal transduction pathway and disassembly of filamentous actin that leads to the collapse of cytoskeleton and cell rounding (Hecht, Potoulakis et al. 1988). Bowel fluid released from damaged epithelial cells containing polymorphonuclear neutrophil (PMN), lymphocyte, serum protein, erythrocyte and mucus is inflammatory. The toxins can also invoke inflammation through their ability to act as chemoattractant for PMNs and stimulate release of mediators such as tumor necrosis factor alpha (TNF∝) and interleukin and (Pothoulakis, Castagliuolo et al. 1993; Henderson, Wilson et al. 1999). The infiltration and damage to the colonic mucosa result in the accumulation of fibrin, mucin, dead cells and leukocytes forming yellowish patches of separate lesions on the mucosal surface. These eventually coalesce into a sheetlike layer called pseudomembrane that distinguishes PMC from other types of colonic infection (Price and Davies 1977; Kelly and LaMont 1998) (Fig. 1.2A,B). PMC is a potentially lethal gastrointestinal disease characterized by exudative plaques with necrosis of the intestinal mucosal surface. 1.5. Disease management Aside from diarrhea, abdominal pain, tenesmus and fever are other common symptoms of C. difficile-mediated colitis (McClane and Mietzner 1999). The disease can be fatal as it can lead to colonic perforation or systemic toxicity if left untreated. The treatment of choice involves A B Figure 1.2. Morphology of pseudomembrane in the colon. A. Endoscopic image of PMC with arrows pointing to pseudomembranes. B. Microscopic image of pesudomembrane with a “volcanic eruption” appearance. Images were reprinted from Brian W. Hurley and Cuong C. Nguyen, “The spectrum of pseudomembranous enterocolitis and antibioticassociated diarrhea (2002)”. discontinuance of use of offending antibiotic and commencement of efficacious drugs against C. difficile such as oral vancomycin or oral metronidazole (Briceland, Quintiliani et al. 1988; Peterson and Gerding 1990). Clindamycin, lincomycin, ampicillin or the cephalosphorins were involved in many cases of PMC and CDAD whereas aminoglycosides, trimethoprimsulfamethoxazole, erythromycin and the fluoroquinolones were less likely causes (Silva, Fekety et al. 1984; Bingley and Harding 1987; McFarland 1998; Apisarnthanarak, Razavi et al. 2002; Hurley and Nguyen 2002; Safdar and Maki 2002). Once therapy is discontinued, relapses occur in 10 to 20% of cases due to failure to clear the organism and restore the normal microbiota. In this case, various management approaches have been recommended like improvement on handwashing and use of barrier precautions such as isolation of symptomatic patients (Samore 1999), fluid and electrolyte replacement and administration of agents that slows intestinal motility (i.e., Lomotil), slow and tapering vancomycin therapy (Tedesco, Gordon et al. 1985), use of rifampin or cholestyramine (Tedesco 1982; Buggy, Fekety et al. 1987), bacteriotherapy with fecal enemas (Tvede and Rask-Madsen 1989), oral administration of nontoxigenic C. difficile (Seal, Borriello et al. 1987), and treatment with the yeast Saccharomyces boulardii (Surawicz, Mc Farland et al. 1989). 1.6. Virulence Factors 1.6.1. Large clostridial cytotoxins (LCT) The most studied diseases caused by C. difficile are those with symptoms caused by the largest known single-molecule bacterial toxins, toxin A and toxin B (Dove, Wang et al. 1990). These are well-studied amongst the clostridial exotoxins and cytotoxins and are encoded within a 19.6 kb pathogenicity locus (PaLoc) of the C. difficile chromosome (Fig. 1.3). PaLoc contains a putative positive regulator gene tcdD, LCT genes tcdA and tcdB, a putative holin gene tcdE and a negative regulator gene tcdC. The toxins have no recognizable signal sequence and not appear tcdD tcdB -SH 555bp tcdE -SH 7098 bp tcdA -SH 501bp tcdC -SH 8133 bp 695 bp Figure 1.3. The pathogenicity locus (PaLoc) of C. difficile VPI 10463 showing conserved regions (GenBank accession nos. X51797, X53138, X92982, U25131, U25132). Several gene portions encode for conserved structural features including the glucosyltransferase or catalytic domains (striped block), nucleotide binding sites (solid block), hydrophobic transmembrane domains (checkered block), repeating units (open block) and binding domain for attachment to host cell receptor (speckled arrow). Solid circles represent the DXD motif which is part of the catalytic domain responsible for binding of Mn2+ whereas –SH symbolize conserved cysteines. The length of genes are numerically indicated below the arrows (not drawn to scale) while arrowheads show the transcriptional direction and line segments represent the size of monocistronic and polycistronic transcripts. The figure is not drawn to scale for simplicity. to be proteolytically activated, as both toxins are released upon bacterial autolysis (Dove, Wang et al. 1990). They share around 49% of amino acid sequence identity with extensive structural similarity in the C-terminal third consisting of small repeating subunits within larger units (Fig. 1.3). This portion is involved in receptor-binding specifically to galactose-rich residues and has similarity to glucosyltransferases of Streptococcus mutans and Streptococcus sobrinus (GtfB, GtfC and GtfI) which can bind to carbohydrates (von Eichel-Streiber, Laufenberg-Feldmann et al. 1992). Since monoclonal antibodies against the repeating subunits (amino acid residues starting at 2097 and 2355) neutralize toxin A enterotoxic activity and inhibit its binding to carbohydrate receptors, the repeating subunit portion appears to be immunodominant. Galα1-3Galβ1- 4GlcNAc on human intestinal cells has been identified as the toxin A receptor and it was suggested to be the same receptor for toxin B (Lyerly and Wilkins 1995). Differences in receptor composition and distribution may contribute to the level of toxicity among intestinal cells. With about 50% homology, the N-terminal regions of LCTs are composed of a central hydrophobic domain that represents a membrane spanning region involved in receptor-binding, translocation of enzyme portion into the cell cytoplasm and intracellular processing. It is a conserved domain with cysteine residues and a putative nucleotide-binding domain that is involved in the glucosylation of G-proteins (Fig. 1.3). Site-directed modification of toxin B histidine residue of the nucleotide-binding site to glutamine resulted in 90% loss of toxic activity (Aktories and Just 1995; Hofmann, Busch et al. 1997). The enzymatic activity of toxins A and B was traced to a 63 kDa recombinant fragment located at around 516 to 542 residues of the Nterminal region. These findings highlight the critical role of the N-terminal region in cytotoxicity (Barroso, Moncrief et al. 1994). Consistent to their considerable sequence homology, recent studies on both toxins suggest similar molecular action (Jander, Rahme et al. 2000). Upon binding to membrane receptors and internalization, the toxins act as monoglucosyltransferases capable of modifying 10 Table 2.2. Oligonucleotides used in PCR amplification of cdt, tcdE and 16S rDNA Primer Sequence (5'-3')a Pda259 GAGTTGGTAGAAAGGTGG Polarityb Nucleotide Position Reference F 1170-1187 X53138 2532-2515 Pda260 GATAAGTCTCCTCTACGT R CAP1 GACACTCTCGAGACATCACCGTCC na X53138 CAP2 GATCGGACGGTGATGTCTCGAGAGTG na M13-For GTAAAACGACGGCCAGT F 3162-3178 U25061 M13-Rev GGAAACAGCTATGACCATG R 3388-3370 U25061 ExtcdR CAATTACTAATCCTTTTATGTTTCC R 38-14 AF271719 ExtcdF1 ATATTGGGAGGGAGAATAA F 524-542 AY029209 AY029209 na Walker, 2002 na Walker, 2002 ExtcdF2 AAAGTTCAAGAGTTAATT F 500-517 cda3 TCTCGAGAATTTGCTTC R 359-343 AF271719 cda4 AAGATCTGGTCCTCAAGAATTTGG F 1035-1058 AF271719 cda5 CTGGAGATTCAAAATAATAGACATAC R 442-417 AF271719 cdb3 GAACTAATAACTCTCTATCGTCTGG R 4061-4037 AF271719 cdb4 TTGTCTTTATCCAGAAGTTTATCTAC R 1725-1700 AF271719 cdb7 ATGTTAAACTTGAAAGAGGAATGA F 3249-3272 AF271719 cdb8 GGAGATCCAAATCAGCCTAAAAC F 32-3954 AF271719 Rcda-For GAAGCAGAAAGAATAGAG F 217-234 AF271719 Rcda-Rev ATTAGGTAACAAACCCTCA R 1609-1591 AF271719 Rcdb-For GTGGGAAGATAGTTTTGC F 732-749 AF271719 Rcdb-Rev CTGAGCCTTGTAAACCATC R 1939-1921 AF271719 Rtcde-For ATGCACAGTAGTTCAC F 9329-9344 AJ011301 Rtcde-Rev CCAACTGACCATGCAC R 10056-10041 AJ011301 CD16S-For GAATATCAAAGGTGAGCC F 180-197 AF072473 CD16S-Rev CAATCCGAACTGAGAGTA R 1261-1244 AF072473 cda-F1 TTGCAATACTACTTACAAGGCTTC F 132-155 L76081 cda-R1 TCATATTCAGGGGAAGTAAGAGTTA R 1085-1061 L76081 cdb-F1 ACTCCCAAACAATGGATTAATGGG F 1591-1641 L76081 cdb-R1 TTGACATTACTCCATGTACTAGGG R 3351-3328 L76081 pQE5' CCCGAAAAGTGCCACCTG F QIAGEN QIAGEN pQE3' GTTCTGAGGTCA R QIAGEN QIAGEN Ecda-F2 CGCGGATCCATGAAAAAATTTAGG F 132-155 L76081 Ecda-R2 CCCCAAGCTTATATTAAGGTATCAA R 1085-1061 L76081 Ecdb-F2 CGCCTGCAGATGAAAATACAAATG F 1591-1641 L76081 Ecdb-R2 GGGCTGCAGTACTAATCAACACTA R 3351-3328 L76081 CDTaY344-For TTCCAACTAATTTAACTGTA(GCA)ATAGAAGATCTGC F 1010-1031 AF271719 CDTaY344-Rev TACAGTTAAATTAGTTGGAATAGGTTCACG R 1017-1000 AF271719 CDTaR345-For CAACTAATTTAACTGTATAT(GC)(CT)AAGATCTGCTCC F 1013-1034 AF271719 CDTaR345-Rev ATATACAGTTAAATTAGTTGGAATAGGTTC R 1020-1003 AF271719 CDTaS388-For TGTCTTATCCAAACTTTATT(CGT)(CTA)TACTAGTATTG F 1142-1174 AF271719 CDTaS388-Rev AATAAAGTTTGGATAAGACAGTGCTTGTCC R 1161-1132 AF271719 CDTaE430-For CAGGTTATGCAGGTGAATATG(C)AGTGCTTTTAAATC F 1268-1303 AF271719 CDTaE430-Rev CATATTCACCTGCATAACCTGGAATAGCTGAT R 1288-1257 AF271719 mutseqchk-A GTGGGAAGATAGTTTTGC F 732-749 QIAGEN mutseqchk-B GGTCCAGTAAATAATCCT R 951-934 AF271719 a Restriction endonuclease recognition sequences are in bold; mutated nucleotides in parenthesis b F-forward, R-reverse, na-not applicable 46 (Table 2.2) was added into a 50 µl 1XEE reaction which was heated to 100oC for then slowly cooled to allow annealing of complementary strands. The adapter was covalently linked to duplex subtraction products. 2.2.2. Genomic subtraction: hybridization Procedures were modified from Straus and Ausubel (1990). Target (0.5 µg) and subtractor (10 µg) were mixed at 1:20 mass ratio in 25 µl 2XEE reaction volume containing 20 µg yeast tRNA (Sigma, MO) as carrier. The mixture was boiled for min, snap cooled, mixed with 20 µl of 2M NaOAc, µl TE-saturated phenol, overlaid with mineral oil and incubated in 65oC shaking waterbath for 24 hours. To extract unhybridized subtractor and biotinylated hybrid DNA, 50 µl of 2.5XEE with 10 µg of ImmunoPure streptavidin (Pierce) was added to the mixture before shaking at 180 rpm for 30 and phenol/chloroform extraction. The interface layer was back extracted with 200 µl EEN and pooled with non-streptavidin bound DNA portion. One microliter aliquot of the 10 µl 1XEE mixture was saved for analysis from each subtraction round and the remaining µl was subjected to subsequent rounds of subtraction by combining with excess biotinylated subtractor DNA and yeast tRNA as above. The unbound DNA from each round was resuspended in 500 µl EEN, subjected to high temperature incubation step (80oC) then purified in a final volume of 20 µl EE. This step denatured DNA fragments with melting temperature (Tm) below or around 65oC, as these may not anneal efficiently with its biotinylated complement and thus move into the unbound fraction of the hybridization mixture. The application of high temperature minimized capping and amplification of low Tm fragments. A total of rounds of denaturation, reannealing and streptavidin extraction were performed with subtractive products ligated to adapter DNA then amplified using cap1 with the following cycle profile: cycle of at 94oC; 35 cycles of 30 sec at 94oC, 30 sec at 55oC and at 72oC; followed by cycle of at 72oC. Product was used as probe to 19126-pUC18 plasmid library. A schematic diagram is presented in Figure 2.1. 47 2.2.3. Library construction Two microliters of unbound unique DNA from each round was ligated to 1.5 µl of 25 ng/µl adapter in a 10 µl ligation mix containing buffer and T4 DNA ligase (Promega) incubated at 22oC for hours. The enzyme was heat inactivated and µl of capped DNA was used as template in a 50 µl PCR reaction containing µM CAP1 primer, 200 µM of each deoxyribonucleoside triphosphate, 1.5 mM MgCl2, 1X Taq polymerase buffer and µ Taq polymerase at the following cycle profile: cycle of at 94oC; 35 cycles of 30 sec at 94oC, 30 sec at 55oC and at 72oC; followed by cycle of at 72oC. Round amplicon was used to screen C. difficile 19126 genomic library. To construct the library, 10.5 µg from a 3.5 µg/ul of 19126 DNA stock was partially digested with endonuclease Sau3AI (New England Biolabs) for 20 in a 50 ul mix. The DNA digests were purified using the QIAquick purification kit (Qiagen), ligated to U BamHI-digested and U calf intestinal alkaline phosphatase-treated (New England Biolabs) gel purified pUC18. Two microliters of ligation mixture was electroporated into competent E.coli JM109 cells at 200-600 ohms resistance and 25 µF capacitance setting. 2.2.4. Screening of clones A total of 292 white colonies were picked with sterile applicator stick and grown overnight in duplicate LB-ampicillin plates. Colony lifts were prepared in three duplicate 82 cm diameter nylon membrane discs of 0.45 µM pore size Hybond N+ nucleic acid transfer membrane (Amersham Biosciences) which were placed onto the colonies for an additional h. For cell lysis and nucleic acid fixation, discs were placed for on two sheets of Whatmann 3MM paper saturated with 0.5M NaOH then washed in 400 ml of 5XSSC for 10 with agitation on an orbital mixer (Biometra WT17). The unique 4th round DNA probe (5 ng) was boiled for min, snap cooled and labeled with the ECL system as recommended (Amersham Biosciences). In 48 Biotinylated, sheared, subtractor DNA Restricted-target DNA denature, hybridize Cycle repeat streptavidin beads Unbound DNA Bound DNA (removed) Adaptor capping CAP1 primer Probe labelling PCR amplification * * Figure 2.1. Schematic illustration of genomic subtractive hybridization process. 49 the Autoblot Micro hybridization oven (Bellco Glass, NJ) the discs were prehybridized in roller tubes for 15 prior to addition of 30 µl of probe solution. Hybridization, washes, chemilluminescence generation and detection were performed following manufacturer recommendation. Plasmids from colonies with distinct signal were initially characterized for mass size increase by restriction profiling. Inserts were sequenced (GenBank accession nos. CC927338-CC927348) using M13 universal forward and reverse primers (Table 2.2) and sent for identity search against annotated sequences deposited in GenBank through the NCBI BLASTn and BLASTx programs. Specificity of 4th round unique DNA to pathogenic DNA was also tested in a dot blot assay. 2.2.5. Total RNA purification Aliquot from mid-log phase BHI culture (20 ml) was subcultured into 400 ml prereduced BHI. Inoculum was standardized at 0.25 absorbance value (OD600nm). Cells were harvested at specified timepoints, pelleted at 5000 rpm for at -4oC. RNA was extracted using TRIZOL reagent (Invitrogen Life Technologies, CA). Pellet was resuspended in ml TRIZOL and lysed by pipeting through filtered tips. Mixture was vortexed with 200 µl chloroform and centrifuged at 13,000 rpm for 15 at 4oC. RNA was precipitated from the upper aqueous phase with 500 µl isopropyl alcohol for 10 at room temperature then spun as before. The pellet was washed with ml of 75% ethanol, spun, vacuum dried, redissolved in 100 µl of 1X RNase-free DNase buffer with 50 U DNase (Promega) and incubated at 37oC for 30 min. The reaction was stopped by incubating in 10 µl of DNase stop solution (20 mM EGTA, pH 8.0) at 65oC for 10 min. Thereafter, the RNA solution was extracted once with phenol and chloroform/isoamylalcohol (24:1), precipitated with volumes of 85% ethanol and redissolved in 50 µl DEPC-treated ddH2O. RNA was quantified and checked for purity by UV spectrophotometry and analysed in 1% TAE-agarose gel. 50 2.2.6. Reverse Transcription-PCR (RT-PCR) First strand cDNA was synthesized by first incubating µg RNA template and 20 pmol of reverse sequence specific primer (Table 2.2) in 10 µl nuclease-free H2O at 70oC for (annealing). The mixture was brought to 19 µl with DEPC-ddH2O containing µl 5X reaction buffer, µl 10 mM dNTP, 20 U ribonuclease inhibitor before incubation at 37oC for min. RT was then carried out by adding 200 U of RevertAid reverse transcriptase (MBI Fermentas, GmbH) at 42oC for 60 min. The reaction was stopped at 70oC for 10 and stored at -20oC. Non-RNA template and no-transcriptase control reactions were included to ensure absence of RNA and enzyme contamination. The 50 µl PCR reaction mixture contained µl cDNA, 0.5 µM of each primer pair (Table 2.2), 500 µM dNTP, mM MgCl2, 1X buffer, U Taq DNA polymerase (Promega) and water. PCR was performed in triplicate trials using gradient Thermocycler with conditions set once at 94oC for followed by 30 cycles at 94oC denaturing for 30 sec; variable primer annealing temperature for 30 sec; elongation at 72oC for variable duration and final extension at 72oC for min. As an internal control, 16S rRNA was amplified using specific primers at lower 0.05 M final concentration to achieve comparable transcription level of an otherwise abundant species in the total RNA. Samples were visualized on 1% agarose gel and band intensities were quantified using the Total Lab software (Amersham Biosciences). 2.2.7. Real-Time PCR Quantitation was conducted in quadruplicate using the Rotor-Gene 2000 Real-Time cycler (Corbett Research, Sydney, Australia) at the following cycle program: Hold1 at 95oC for 450 sec; Hold2 at 95oC at 450 sec; 50 cycles at 94oC for 30 sec, variable annealing temperature for 40 sec, 72oC for 60 sec, and 72oC for 40 sec (acquiring on Sybr-Green); and Hold3 at 72oC for 120 sec. The reaction mixture contained µl of cDNA template, 12.5 µl of 2X QuantiTect SYBR Green PCR Master Mix (Qiagen), 10 pmol of each gene-specific primer pair, and 51 supplementary mM MgCl2 in 25 µl total volume. The master mix consisted of the following: SYBR Green I, mM MgCl2, dNTP mix with partial substitution of dTTP by dUTP allowing use of uracil-N-glycolase (UNG) pretreatment, modified Taq DNA polymerase activated by a 15 min, 95oC incubation step and inactive at room temperature preventing primer dimer formation and mispriming; and fluorescent dye ROX which serves as internal reference for normalization of the SYBR green fluorescent signal. Non-template control in which template cDNA was replaced with 40 mM Tris-HCl buffer also accompanied each run to rule out the presence of nucleic acid contaminants. 2.2.8. Derivation, cloning, expression and purification of CDT C. difficile virulence gene fragment insert from genome-subtracted library clone GS80 (GenBank accession nos. CC927338-CC927348) was traced to cdtB of CD196 (Perelle, Gibert et al. 1997a). Primer pairs cda-F1/R1 and cdb-F1/R1 (Table 2.2) were designed to screen C. difficile strains and clone cdt orfs into pCR2.1 (Top10 host, Invitrogen Life Technologies, CA) using the following cycle profile: cycle of at 94oC; cycles of 30 sec at 94oC, at 50oC and at 72oC; 30 cycles of 30 sec at 94oC, at 50oC and at 72oC. Inserts of pDA572 in SK918 and pDA573 in SK919 which were sequenced with primer pairs pQE5’ and pQE3’ (Table 2.2) contained the complete binary orfs (GenBank accession no. AF271719). While primers for cloning were initially designed, identical primer pairs flanked with restriction sites were then designed for directional cloning of cdtA and cdtB in pQE-30 including Ecda-F2 with BamHI/Ecda-R2 with HindIII and Ecdb-F2 and Ecdb-R2 both with PstI (Table 2.2). E. coli M15 transformants SK1214 (pDA577), SK1215 (pDA578), and SK1216 (pDA576) with respective cdtA, cdtB, cdtA/B constructs fused N-terminally to 6X Histidine tag under T7 promoter control were expressed following manufacturer instructions (QIAGEN). Briefly, cytoplasmic extract was derived from overnight 100 ml subculture, grown to OD600 = 0.6 before induction with IPTG at 0.5 mM final concentration and grown for additional h. Cells were lysed in buffer containing 52 50 mM NaH2PO4, pH 8.0; 250 mM NaCl; 0.2 mM phenylmethyl sulfonyl fluoride (PMSF) and mM imidazole, then sonicated on ice at 10 µ setting, cycles of 10 sec duration with 20 sec intercycle rest. The supernatant was separated from insoluble fraction by centrifugation at 13,000 rpm for 20 min. Total protein was precipitated with 70 % ammonium sulphate, resuspended in ml 1X PBS and extensively dialyzed against 10 mM Tris HCl, pH 7. Recombinant CDTs were purified using Ni-NTA affinity chromatography as described (QIAexpressionist handbook, QIAGEN). Washing was done using buffers of increasing imidazole concentration at 20-50 mM, whereas 250 mM imidazole buffer was used to elute bound proteins. Eluate fractions (1 ml) derived at a flow rate of 0.25 ml/min were analyzed in 10% SDS-PAGE, desalted and concentrated by ultrafiltration using Cerntricon YM-30 and YM-50 MW membranes (Millipore, MA). Protein concentration was determined and protein bands analyzed on 10-12% SDS-PAGE gels. Cytoplasmic extract from SK1203 (M15 with pQE-30) was also purified as assay control. CDT proteins were activated in 200 µg/ml trypsin-Tris buffer for 20 at 37oC followed by 300 µg/ml trypsin inhibitor for 30 at similar temperature. 2.2.9. Site-directed mutagenesis The 1.4 kb cdtA fragment in pDA577 served as template for mutagenesis using the GeneTailor site-directed mutagenesis system (Invitrogen Life Technologies). Plasmid (100 ng) was first methylated in small scale reaction containing 1.6 µl of methylation buffer and 10X SAM and µl of 4U/µl DNA methylase in 16 µl of dH2O for h at 37oC. Mutagenesis reaction was carried out in a 50 µl PCR mixture composed of 20 ng methylated DNA (3 µl), 1X final concentration of high fidelity PCR buffer (5 µl of 10X stock), 0.3 mM of dNTP (1.5 µl of 10 mM), mM MgSO4 (1 µl of 50 mM), 0.3 µM of each primer (1.5 µl of 10 µM)(Table 2.2), 2.5 U (0.5 µl) of Platinum Taq High Fidelity DNA polymerase in quantity sufficient of dH2O. The cycling parameters used were as follows: 1X of at 94oC; 30X of 30 sec at 94oC, 30 sec at 53 55oC and 6.5 at 68oC; and 1X 10 final elongation at 68oC. Overlapping primer pairs of about 30 nucleotides per member were designed based on cdtA sequence with a mutagenic primer per pair encoding the target mutation and located downstream from and adjacent to the overlapping region (Table 2.2). The mutagenesis mixture (2 µl) was transformed into One Shot Max Efficiency E. coli DH5α-T1which circularized the linear double-stranded mutated product and digested the methylated template with endogenous McrBC endonuclease. The lacZα gene in the control plasmid was simultaneously modified with control primer pairs mutC1encoding a two-base substitution that introduces a HindIII site and stop codon within the gene and mutC2 (Invitrogen), producing white colonies on plates containing LB-ampicillin supplemented with Xgal. Mutation was confirmed through characterization in 1% agarose gel and sequencing. Recombinant plasmids were then electroporated into pQE-30 for comparative expression. 2.2.10. ADP-ribosylation assay (ARTase) The level of CDT-mediated attachment of radiolabeled ADP-ribose moiety from [32P]NAD to actin was quantified according to described methods (Nagahama, Sakaguchi et al. 2000; Barth, Preiss et al. 1998). The 40 µl total assay mixture contained 100 ng/ml purified wildtype, truncated or mutated CDTa, [adenylate-32P]NAD at 25 mCi/mmol (0.5 µM), 40 µg/ml mammalian cell lysate protein or 3.75 µM rabbit muscle actin, 1mM DTT, 40 µM ATP, 50 µM CaCl2 and 50 µM MgCl2 in 40 mM Tris-HCl, pH 7.5. Assay mixture containing CDTa and actin was either preincubated with affinity purified E. coli M15 host lysate with pQE-30 vector only (SK1203) as control, 0.2 µM novobiocin or other potential inhibitor compounds at 50, 100, 200, 400 µM concentrations for 20 at 37oC prior to addition of labeled NAD and further incubation for h at 37oC. To arrest reaction, 20 µl of 2X SDS-PAGE loading buffer was added to the mixture before separation in 12% SDS-PAGE at 180V for h using an 18x16cm vertical gel apparatus (Hoefer Scientific Instruments, CA). The gel was Saran-wrapped, dried, exposed 54 to general purpose phosphor storage screen for h and scanned on Typhoon phosphorimager (Amersham Biosciences). Bands were measured in pixel unit corrected for background signals from buffer-treated controls and standardized with respect to corrected mean positive control values. Experiments were conducted in triplicate and images were analyzed using the Total lab software. During preliminary assays, reaction mixture was precipitated on ice for 30 by mixing in 500 µl cold 7.5% trichloroacetic acid and 10 µg BSA followed by two ml cold 7.5% TCA washes. For quantification, radioactive bands were gel excised and activity measured in a liquid scintillation counter LS 6500 (Beckman Coulter, CA). 2.3. Specific protocols for results chapter 2.3.1. Cells and reagents HCT 116 human colorectal carcinoma, HepG2 hepatocarcinoma and N1E-115 mouse neuroblastoma cells were obtained from the American Type Culture Collection (Rockville, MD). C. difficile strains were from the Culture Collection University of Göteborg (CCUG). Adenylate [32P]NAD and cAMP Biotrak enzymeimmunoassay (EIA) system were from Amersham. Fluorescent conjugate deoxyribonuclease I (DNase I)-Oregon green 488 and Jasplakinolide were from Molecular Probes (Eugene, OR). The Bio-Plex phosphoprotein reagent kit was supplied by Bio-Rad and and TMB (3,3',5,5'-tetramethylbenzidine) One Solution substrate for peroxidase conjugates by Promega. Phalliodin-tetramethylrhodamine isothiocyanate (TRITC), anti-rabbit IgG-fluorescein isothiocyanate (FITC), rabbit anti-actin, monoclonal mouse anti-talin and antiphospho-p38 MAPK, sheep anti-phospho-BAD, rabbit anti-Rho, goat anti-mouse and anti-rabbit peroxidases, novobiocin, SB203580, cytochalasin D, trypsin and trypsin inhibitor were purchased from Sigma (St. Louis, MO). Recombinant CDTa and CDTb were propagated as N-terminal histidine-tagged fusion protein in pQE-30 (Qiagen), purified using anti-His affinity resin, desalted and concentrated by YM-30 membrane ultrafiltration (Millipore) then activated with µg trypsin per µg CDT followed by µg per µg trypsin inhibitor. 55 2.3.2. Cell culture HepG2 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with fetal calf serum and 100 µg/ml each of penicillin and streptomycin. The medium used for HCT 116 was McCoy’s 5A (Sigma) with additional 2.2 g/L of NaHCO3 and 1.5 mM/ml L-glutamine. N1E-115 cells grew well in DMEM with 4500 mg/L D-glucose content without sodium pyruvate and L-glutamine. HepG2 and HCT 116 were routinely harvested in 0.1% trypsin-0.05% EDTA solution whereas modified Puck’s D1 solution was used for N1E-115 containing 5.5 mM glucose, 5.4 mM KCl, 58.4 mM sucrose, 0.17 mM Na2HPO47H2O, 138 mM NaCl and 0.22 mM KH2PO4. Cell to medium subcultivation ratio for HepG2 and HCT 116 was at 1:8 while 1:3 was employed for the less luxuriant N1E-115. Cells were incubated at 370C in 5% CO2. 2.3.3. Cytotoxicity assay and confocal microscopy Semi-confluent monolayer cultures were reseeded onto 6-well plates with coverslips at 5x105 cells per well. HCT 116 and HepG2 cells were grown for 20 h while N1E-115 cells were grown for 42 h to near confluency. Culture was washed twice with 1.5 ml 1XPBS (pH 7.4) and replaced with ml medium containing 200 µl supplement with: 40 mM Tris-HCl buffer (pH 7.5); 200 ng/ml of purified trypsin-activated CDTb for 15 followed by 100 ng/ml CDTa; or individual components. Plates were incubated for h (confocal microscopy) or at designated timepoints (cytotoxicity assay). For cytotoxicity assay, cells were washed 3X and fixed in ml 3.7% formaldehyde in PBS for 15 min. Coverslips were then air-dried for min, mounted onto 20 µl of 60% glycerol-PBS, dried for additional then sealed with nail polish. Eight fields of 400X magnified micrograph images per timepoint were counted for percentage of rounded cells. For confocal microscopy, cell processing and staining were as recommended by Molecular Probes. Briefly, fixed cells were permeabilized in ml 100% cold acetone at –20oC for followed by PBS rehydration and three washes. Staining was performed for h in ml PBS 56 solution containing 0.5 µM DNaseI-Oregon green (excit. 496 nm, emm. 524 nm) and 0.3 µM Phalloidin-TRITC (excit. 385 nm, emm. 470 nm). Mounting of coverslips were performed as above and slides were stored at –20oC if not viewed immediately. Microscopy parameters were set as follows: 830 V PMT at 10% argon ion laser power for Oregon green (488 nm) and 10% helium neon laser power for TRITC (543 nm). 2.3.4. Thymidine assimilation Incorporation of DNA precursor [63H]-thymidine upon CDT treatment was compared with SK1203-treated control. HCT 116 monolayer maintained in McCoy’s 5A (Sigma, MO) and routinely passaged at 1:8 subcultivation ratio was reseeded into 25 cm2 tissue culture flask with 5x104 cells and grown for 20 h to partial confluency. Medium was replaced with that containing [3H]Thymidine at 20 mCi/mmol with 200 ng/ml CDTb for 15 followed by 100 ng/ml CDTa or SK1203 protein or individual CDT components. At designated timepoints, cells were lysed in 0.5% Triton X-100 in 40 mM Tris-HCl, pH 7.5. After 10 centrifugation at 13000 rpm, supernate aliquot was mixed with scintillant cocktail (1:10) and radioactivity measured using MicroBeta liquid scintillation counter (PerkinElmer, MA). Experiments were performed in four trials with batch counts detected thrice. Data values in counts per minute were corrected by subtraction of background counts from control. 2.3.5. ARTAse The 50 µl total assay mixture contained µM radiolabelled NAD at 25 mCi/mmol, 40 µg/ml cell lysate, 50 ng/ml CDTa, mM DTT, 40 µM ATP, 10 µM MgCl2 in 40 mM Tris-HCl, pH 7.5. Assay mixtures containing CDTa preincubated (20 min, 37oC) with 0.2 µM novobiocin or affinity purified lysate of E. coli M15 with pQE-30 vector only (SK1203) were used as negative controls. Reaction incubated at 37oC for h was arrested by adding 20 µl 2X SDS- 57 PAGE loading buffer before electrophoretic separation. The gel was processed as in section 2.2.10. 2.3.6. Flow cytometry Colonic cell suspension was seeded into 25-cm2 tissue culture flask at 3.6X104cells/ml and grown to near confluency. Medium replacement (8 ml) was incorporated with 40 mM TrisHCl or 200 ng/ml CDTb followed by 100 ng/ml CDTa. In some experiments, pretreatment with increasing concentrations of Cytochalasin D or Jasplakinolide were added for 30 prior to addition of CDT and incubation for another h. Cells were washed, harvested and fixed in ml of 0.5% formaldehyde for 15 min. Routine washings were performed twice by resuspension in ml 1XPBS in 15 ml tubes followed by spin at 1500 rpm, 4oC. Cells were then permeabilized in 0.1% triton X-100, 5% glycerol, 2mM Mg Cl2 and 0.2 mM DTT for and stained in 300 µl PBS with 0.3 µM DNaseI-Oregon green and 0.3 µM Phalloidin-TRITC for h. Cells were washed, resuspended in 500 µl cold PBS and stored at 4oC prior to cytometric analysis within the next 24 h. For indirect staining, incubation in 500 µl blocking solution (1% FCS, 0.1% BSA in 1XPBS) with 1.2 µg rabbit anti-actin for h was followed by µg of goat antirabbit-FITC conjugate for 30 before final resuspension. Cells were analyzed using FACSVantage SE (Becton Dickinson) at 488 nm excitation and 525 nm emission wavelength for Oregon green and 575 nm emission wavelength for TRITC. Fluorescence optics consisted 520/30 bandpass filter for green and a 625/42 bandpass filter for red emission. Necessary compensation was done to minimize signal crossover. Experimental trials were conducted three times with fluorescence data measured in triplicate from 20,000 cells using or decade logarithmic amplifiers. WinMD1 was used to analyze data on mean fluorescence intensities (MFIs). Mean comparisons were performed using student’s t test. 58 2.3.7. ELISA and western blotting Intracellular level of cAMP was measured according to cAMP Biotrak EIA protocol (Amersham). Talin, Rho and phospho-p38 MAPK levels (with or without 30 pre-incubation with µM SB203580) were detected. HCT 116 monolayer was treated with 200 ng/ml CDTb and 100 ng/ml CDTa or increasing CDTa concentrations. HCT 116 lysate was extracted by three freeze(-80oC)-thaw (45oC) cycles at specified timepoints. Lysate proteins were diluted to 10 µg/ml with 0.015 M carbonate-0.035 M bicarbonate coating buffer, pH 9.6. Microplate wells were coated with 100 µl of undiluted and diluted (10-1 to 10-6) lysate mixtures then incubated overnight at 4oC. Plates were washed 5X with 100 µl of 0.05% Tween 20 in saline, pH 7.4 (saline-tween), blocked with 200 µl of 3% bovine serum albumin (BSA) in incubation buffer, pH 7.4 (PBS-Tween) for 30 at 37oC then washed as before. BSA blocking was followed by sequential incubation with 0.2 µg/ml of primary antibody then anti-mouse (1:40,000) or antirabbit (1:10,000) HRPO conjugates for 90 each. TMB substrate reaction was stopped with 100 µl of 1M H2SO4 and measured at OD450nm using microplate reader model 680 (Bio-Rad). For Western blotting, 20 µl of treated HCT lysate was boiled in loading buffer before protein separation in 12 % SDS-PAGE gel. Electroblotting and hybridization were performed using recommended protocols for the Mini Transblot Assembly (Bio-Rad) and ECL Western Blotting detection reagent system, respectively (Amersham Biosciences). 2.3.8. Caspase-3 assay Cysteine aspartic acid specific protease activity in 50 µl HCT 116 lysate treated with CDT (as in ELISA) or 200 ng/ml of cytoplasmic extract from CCUG 20309 (lys20309) with or without pre-incubation with 50 µM Z-VAD-FMK inhibitor, was determined as recommended (colorimetric CaspACE system, Promega). lys20309 is sonicated lysate and concentrated using YM-10 membrane ultrafiltration (Millipore). 59 2.3.9. Multiplex immunoassay Treated HCT 116 lysate (as in caspase-3 assay) was analyzed for phosphoactivated proteins according to recommended procedures (Bio-Plex, Bio-Rad). Briefly, 50 µl of sample (undiluted, 1:10, 1:1000), buffer control and 6-point standards in filter microplates were shaken (800 rpm) overnight with 50 µl premixed and prewashed beads (5000 beads per phosphoprotein) coated with capture antibodies. After vacuum washes, 25 µl per well (1 µg/ml) of detection antibodies were added followed by 50 µl streptavidin-phycoerythrin (2 µg/ml) before final resuspension in 125 µl of assay buffer. Measurement was done in the array reader with data analyzed using Bio-Plex Manager software 2.0 with PL curve fitting. 2.4. Specific protocols for results chapter 2.4.1. ARTase Chemical inhibitors were dissolved in dimethyl sulfoxide (DMSO) as 1mM working solution except for the actin binding proteins. The 40 µl total assay mixture contained 100 ng/ml CDTa, [adenylate-32P]NAD at 25 mCi/mmol (0.5 µM), 40 µg/ml HCT 116 lysate protein or µg muscle actin, 1mM DTT, 40 µM ATP, 50 µM CaCl2 and 50 µM MgCl2 in 40 mM Tris-HCl, pH 7.5. Inhibition assay mixture containing CDTa and actin were routinely preincubated with inhibitor compound at 50, 100, 200, 400 µM concentrations for 20 prior to addition of labeled NAD and further incubation for h at 37oC. The bands were separated and the gel processed as described in section 2.2.10. Bands were measured in pixel unit corrected for background signals from buffer-treated controls and standardized with respect to corrected mean positive control values. Experiments were conducted in triplicate trials. 2.4.2. NAD glycohydrolase assay (NADse) The level of NAD hydrolysis by CDTa was determined as described (Xu, BarbanconFinck et al. 1994). The 50 µl reaction mixture contained 100 ng/ml CDTa, [nicotinamide- 60 H]NAD at 30 mCi/mmol, 10 mM DTT, 20 µg BSA and specified inhibitor concentration in 40 mM Tris-HCl (pH 7.5) incubated for h at 37oC. Free nicotinamide was extracted by the addition of 250 µl water-saturated ethyl acetate, 300 µl of which was mixed with 1.8 ml of scintillant cocktail and the amount of radiolabeled nicotinamide was determined using liquid scintillation counting. Quadruplicate assays were performed and measurements were corrected by subtraction of background values from non-specifically hydrolyzed NAD. 2.4.3. Photoaffinity labeling NAD binding to actin by photo-crosslinking was determined. For saturation studies, the 40 µl reaction mixture contained µg actin incubated for with increasing concentrations of [adenylate-32P]NAD in 40 mM Tris-HCl prior to UV irradiation for 10 at cm distance, 254nm and 60 W/cm2 intensity (Ultra-Lum, CA). For competition studies, [32P]NAD at 50 mCi/mmol was irradiated in the presence of µg actin or 300 ng/ml CDTa which were preincubated for with increasing ATP or NAD. For protection studies 100 ng/ml CDTa were preincubated with specified compound (inhibitor/ inducer) concentrations. Proteins were resolved in 12% SDS-PAGE and analyzed by phosphorimaging. 61 [...]... LCTs, a number of C difficile strains simultaneously produce an ADPribosyltransferase (ADPRT) designated as CDT toxin (Perelle, Gibert et al 199 7a) The enzyme can mediate catalysis of nicotinamide adenine dinucleotide (NAD) and attachment of ADPribosyl group to various protein substrates Since several bacteria produce ADPRT (Table 1.1), cdtA 13 92 bp cdtB 26 31 bp Figure 1.5 The cdt locus of C difficile. .. secretion, phagocytosis and more 21 Table 1.1 Bacterial toxins produced as binary or preformed A- B structures Bacteria C difficile C perfringens C botulinum C spiroforme B cereus Toxin (typea) CDTa, CDTb (B) Ia,Ib (B) C2I,C2II (B) Sa,Sb (B) VIP1,VIP2 (B) Activity (substrate) ADPRTb (G -actin) ADPRT (G -actin) ADPRT (G -actin) ADPRT (G -actin) ADPRT (G -actin) Reference Popoff et al., 1988b Schering et al., 1988... reported at only 6% (Korn 19 82) In mammalian cells, actin was classified into 6 major groups namely: the skeletal muscle α -actin, cardiac muscle α -actin, smooth muscle and γ -actin, and cytoplasmic β- and γ -actin, which comprise the 3 isoforms α, β and γ, distinguished by their isoelectric properties (Vandekerckhove and Weber 1979) Alpha -actin is the most acidic while β -actin is partially acidic and the... Popoff, Milward et al 1989; Perelle, Scalzo et al 1997b; Gulke, Pfeifer et al 20 01; Geric, Johnson et al 20 03) Accordingly, C 19 difficile, C perfringens, and C spiroforme can all cause gastrointestinal diseases in humans as well as animals (Borriello and Carman 1983; Braun, Herholz et al 20 00; Stoddart and Wilcox 20 02) , thus implying common evolutionary lineage 1.6 2. 1 ADP- ribosyltransferase Aside from. .. families of ADPRT (Domenighini, Magagnoli et al 1994) Based on 25 studies involving structural modeling and comparative sequence analysis, ADPRTs were classified into the cholera toxin (CT) group which includes CDT and most bacterial mono-ADPribosyltransferases and the diphtheria toxin (DT) group comprised of DT, ETA and eukaroyotic poly -ADP- ribosyltransferases (Domenighini and Rappuoli 1996) X-ray... the γ isoform is most basic Iota toxin which is a close homologue of CDT was shown to to act on all isoforms (Schering, Barmann et al 1988) whereas C2 only ADP- ribosylates the β and γ isoforms (Aktories, Ankenbauer et al 198 6a; Ohishi and Tsuyama 1986) 22 The actin filament is a polar molecule having a fast-growing (barbed), positive end a slow growing (pointed), negative end with the ATP-bound actin. .. (G-protein) that act as molecular switches” capable of regulating a number of essential functions in mammalian cell including cell adhesion, microfilament organization, nuclear signaling, pseudopod formation and re-shaping (intravasation) of phagocytes and many signal transduction pathways (Aktories and Just 1995) The toxins preferentially glucosylate the GDP-bound form of G-protein because its configuration... 198 6a) Thereafter, iota Ia was discovered to be an ADP- ribosyltransferase whose substrate is the actin monomer (Simpson, Stiles et al 1987; Schering, Barmann et al 1988) while Ib mediates translocation of Ia into cells (Stiles, Hale et al 20 00; Blocker, Behlke et al 20 01; Richard, Mainguy et al 20 02) 23 The functional toxin is composed of a precursor enzymatic or A protein component and a translocation... ADPribose moiety behaves like a capping protein that blocks the positive end the filament Furthermore, ADP- ribosylation inhibits the actin ATPase activity These disturbances may have critical consequences such as breakdown of cytoskeletal network and deterioration of cellular protein movement and function 1.6 .2. 3 Biology of actin- specific ADPRT CDT and other ADPRTs employ a binary mode for intoxication... α3‘ 61-66 is an additional helix at the N-domain not found in VIP2 Reprinted from Tsuge et al 20 03 Furthermore, the C-domain of VIP2 showed significant homology with that of iota Ia (39.9%) and Rho -ADP- ribosylating exoenzyme C3 (30%) from C botulinum but not the Ndomain (Han, Craig et al 1999; Han, Arvai et al 20 01; Tsuge, Nagahama et al 20 03) Indeed, the N-domain of Ia has an additional α–helix (α3’:61-66) . less likely causes (Silva, Fekety et al. 1984; Bingley and Harding 1987; McFarland 1998; Apisarnthanarak, Razavi et al. 20 02; Hurley and Nguyen 20 02; Safdar and Maki 20 02) . Once therapy is discontinued,. of toxin A and toxin B was observed to increase (Yamakawa, Karasawa et al. 1996). Instead of acting as 19 transcriptional regulator therefore, TcdD may function as a sigma factor that promotes. essential functions in mammalian cell including cell adhesion, microfilament organization, nuclear signaling, pseudopod formation and re-shaping (intravasation) of phagocytes and many signal transduction