leal y a flores l l garcía cortés l b cedillo rivera r and torres j 2008 antibody based detection tests for the diagnosis of helicobacter pylori infection in children a meta analysis plos one 3 e3751
... SAB Overlapping Area of Entity A < /b> andB TABC Temporal overlap of Entity A,< /b> Band C SAC Overlapping Area of Entity A < /b> and C pmin Time Constant for Binary Minimal Literal pmax Time Constant for Binary ... spatial, temporal and abstract attributes are modelled This allows the spatial and temporal impact of requirements to be represented for further analysis This research further develops the models ... Binary Maximal Literal xiii Symbol Description qmin Time Constant for Unary Minimal Literal qmax Time Constant for Unary Maximal Literal ent Entity Starti Start of Activity i Duri Duration of Activity...
... Australia and Nava Subramaniam Faculty of Business and Law Deakin University, Victoria, Australia ABSTRACT: This paper reviews the recent European and international literature on i nternal audit independence ... warrants further exploration Finally, alternative research designs could add insight to our understanding ofthe relation between organizational status and internal audit objectivity For example, ... Managerial Auditing Journal 17 (3) : 130 - 137 O’Leary, C andJ Stewart 2007 Governance factors affecting internal auditors’ ethical decision-making: An exploratory study Managerial Auditing Journal...
... Generally, qualitative factors should be used for intrinsically qualitative factors and quantitative factors for intrinsically quantitative ones The legal factors are intrinsically qualitative The ... credit risk may be difficult to build: the historical data will probably be incomplete fora < /b> statistical model, andthe individual model factors are too dynamic Analysts solve the problem by relying ... experiences, profiles, or counterexamples Case -Based Reasoning and Municipal Bond Credit Quality Based on the availability ofthe data, the nature ofthe judgments, andthe style of analyst decisionmaking,...
... scoring criteria There has been little analysisof whether all the rankings of anchor points are correct We have little information about potential differences inthe validity and reliability for low ... interval and ratio scales Both nominal and ordinal scales are well known in psychiatry and GAF is an example of an ordinal scale This has consequences for further treatment of data We cannot say, ... but there has been little testing of whether the error is of any practical interest Similarly, the error resulting from merging raw data into broader categories, andthe use of just one score in...
... carried out by “absolutely using reciprocal capital for ODA projects managed by each locality” applicable to qualified projects approved by the Government Additionally, with respect of rural investment ... farmers, rural civilization and economic growth and also to avoid a < /b> lot of pressures on urban areas They are : - Remain the agricultural labors and also create more jobs in idle months Franc Ellis ... community infrastructure such as rural roads, inland canals, aquaculture infrastructure, village infrastructure, small bridges, capital contributions from investors will be used to build irrigation...
... gastrointestinal tract, particularly the stomach, for both practical and theoretical reasons From a < /b> practical standpoint, the stomach is already commonly intubated in clinical practice for purposes of ... body? JAMA 19 93, 270:1247-1248 73 Soong CV, Halliday MI, Barclay GR, Hood JM, Rowlands BJ, Barros D’Sa AAB: Intramucosal acidosis and systemc host response in abdominal aortic aneurysm surgery ... adopting a < /b> new technology and treatment strategy that requires a < /b> major revision inthe current standard of care until further data from a < /b> multicentric RCT are available; or adopt the technology (and...
... contains variables that represent the precursors, cytoplasmic levels and cell membrane levels ofthe TJ proteins, as well as intracellular levels of activated NF-kappa -B and iNOS mRNA Furthermore, ... behavior is difficult to characterize analytically Therefore, ABMs are not "mathematical models" per se, being able to be subjected to formal analysisand "solved." Rather, the use of ABM falls ... develop a < /b> pulmonary ABM as well Drawing upon the endothelial-epithelial bilayer configuration fora < /b> "hollow" organ, the pulmonary ABM utilizes the same endothelial-inflammatory cell component as...
... Knowledge Graph LCMS Learning Content Management System LIP IMS Learner Information Package LMS Learning Management System LO/RLO Learning Object/Reusable Learning Object LOM Learning Object Metadata ... Metadata LTSC Learning Technology Standards Committee (IEEE -LTSC) PC Personal computer PCK Pedagogical Content Knowledge PI Prime Idea RIO Reusable Information Object RLO Reusable Learning Object ... Engineers IMS Instructional Management Systems IMS GLC IMS Global Learning Consortium IO/RIO Information Object/Reusable Information Object IT Information Technology ITS Intelligent Tutoring System KG...
... are water quality -based approach and technology -based approach Water quality -based approach The key components in water quality -based approach are water quality standards and models As mentioned ... Zealand guidelines for fresh and marine water quality Australian and New Zealand Environment and Conservation Council and Agriculture and Resource Management Council of Australia and New Zealand ... individual wastewater dischargers to industrial wastewater treatment facilities rather than to the sewage treatment systems Table - Areas in Korea and their water quality standards Area Goal of Water...
... those ofthe deadbeat control As can be seen, the linear regulator also exhibits increases For this a < /b> certain performance degradation as controller, as stated before, the main limitation is represented ... SIMULATION RESULTS As stated before, the comparison ofthe simulation results can be performed by evaluating three indices: the line current spectra, the current error rms value, andthe line current ... superiority is also confirmed by the data reported in Tables II and III, where both the current total harmonic distortion andthe error rms value are much lower than those ofthe linear and deadbeat...
... often have anti-bacterial, anti-fungal, anti-inflammatory, anti-oxidant and/ or analgesic properties which may provide alternative natural broad-spectrum therapy for control of AIV in poultry farms ... [120] Catechins alter the infectivity of influenza viruses probably not only by direct interaction with viral HA but also by inhibition of viral RNA synthesis in cell culture [ 133 ] Furthermore, Liu ... possible alternative approaches for control of AIV in poultry particularly against the HPAI H5N1 subtype Antivirals 2.1 Chemotherapy The use of chemotherapeutic agents for control of AIV in poultry...
... children requiring Clinical trials: ethical, practical, psychopharmaca scientific and regulatory recommendations All children Clinical trials: problems and pitfalls All children Clinical trials: ... clinical trial/ or *phase clinical trial/ or *phase clinical trial/ or *phase clinical trial/ or *controlled clinical trial/ AND Limit: recent 10 years Survey of current guidance for child health ... conduct, and reporting of clinical research with children; conducting empirical research relating quality, ethics and reliability of pediatric clinical research to the international standards for design,...
... They plotted the classification accuracy and evaluation reliability fora < /b> number of classifiers, which were generated as a < /b> part ofa < /b> greedy search for kernel parameters and found some linear correlation ... optimal classifier (so accuracy and correlation may only exhibit linear relationship locally) Here, we perform a < /b> similar study except that we sampled the kernel parameter more uniformly (on a < /b> log ... and R0 3- Bottom5 differ from R0 3all by one subset of training examples Since R0 3all’s correlation rates are generally closer to R0 3Top5 than to R0 3- Bottom5, we see that having seen extra training...
... AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT GGAGCCATAATGACAGCAGT using primers and (Table 2), and inserting it into the SalI–BamHI ... part by the Global COE Program ‘Global Center for Education and Research in Integrative Membrane Biology’ from the Ministry of Education, Culture, Sports, Science and Technology of Japan References ... CCCCGCGGCCGCTGACACCGATTATTTAAA TTTTGAGCTCGGAGCCATAATGACAGCAGT TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA...
... the problem A< /b> A < /b> is solvable; A < /b> is called the closure ofA < /b> C Algorithms and Theorems The following are some algorithms and results that show methods and techniques for solving the above problems ... set of attributes Attr(O) = Mv ∪ Mf, with Mv is a < /b> set of simple valued variables; Mf is a < /b> set of functional variables Between the variables (or attributes) there are internal relations, that are ... of simple valued variables anda < /b> set of computational relations over the variables However, there are domains of knowledge based on a < /b> set of elements, in which each element can be a < /b> simple valued...
... Attributes with character values can more naturally be the basis fora < /b> breakdown since they have a < /b> small set of legal values A < /b> breakdown based on such an attribute leads to a < /b> small well-defined ... compare the values ofthe DDAs ofone sub-class with the values ofthe same attributes within a < /b> sibling sub-class The values of relational attributes within a < /b> sub-class are also recorded by ENHANCE ... Examples of these rules include: Flow of control then passes through a < /b> number of modules responsible for calculating thebased DB attribute andfor recording constant DB attributes and relation...
... embody in their blurring of sacrosanct boundaries and polarities such as male/female, high art/pop art, film/TV, fiction/reality and private/public.Two interrelated sign systems developed from ... surfaces and masks Madonna visual style engages and hyperbolises the discourse of femininity- she has bleached hair with dark roots, street smart image yet glamorous Gender play is the mix and ... hearing a < /b> song, because the video can change and correct any perceived ideas This is the case for "Material Girl" The song was telling of money and acquisition, many thinking of Madonna as being...
... of inducing a < /b> stochastic regular grammar from a < /b> sample set of strings belonging to an unknown regular language The most direct approach for solving the task is by S JJ JJ JJ nn jj jj jj ball red ... training set Forthe remainder, we take n-grams to be bigrams There are other approaches to inducing regular grammars besides ones based on n-grams The first algorithm to learn PDFAs was ALERGIA ... to AL and AR , and let SL and SR be the starting symbols of GL and GR , respectively Fix a < /b> POS w inthe PTB Since the auw tomata are deterministic, there exist states SL and w that are reachable...
... transcriptions first acOordin~ to their rhyme determining part and then alphabetically The rhyme determining part consists ofthe nucleus and coda ofthe last stressed syllable andthe following ... weak syllables if any For example, the rhyme determining part of w~rrelea (to whirl) is er-ve-len, of versn6llea (to accelerate) el-lea, andof 6verwdrk (overwork) erk (iii) Print the spelling ... our architecture can be applied advantageously in lexicography RELATRD ~ C H The presence of both static information (morpheancs and features) and dynamic information (morphological rules) in LKBs...