l yu l yu ca 1998 generation of superoxide anion by succinate cytochrome c reductase from bovine heart mitochondria j biol chem 273 33972 33976
Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration
... production of cholesterol 15 Table Summary of clinical evidence linking DILI with mitochondrial dysfunction Clinical evidence • Ultrastructural alterations in hepatocellular mitochondria (megamitochondria, ... individual, rather than a single factor, that will trigger idiosyncratic DILI (Ulrich, 2007) Clinically, idiosyncratic DILI can be manifested by parenchymal necrosis, hepatocellular or cholestatic injury ... fully automated The flexibility offered by the offline 2D-LC setup is especially useful for this study, since the collected fractions cannot be injected directly in MALDI, but rather the collected...
- 226
- 1,830
- 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc
... molecules (see text) Heparin and APC-catalyzed inactivation of FVa (Eur J Biochem 271) 2733 2734 G A F Nicolaes et al (Eur J Biochem 271) complement well the electronegative catalytic groove of ... Structural investigation of ¨ the A domains of human blood coagulation factor V by molecular modeling Protein Sci 7, 1317–1325 29 Honig, B & Nicholls, A (1995) Classical electrostatics in biology ... in human factor V as a cause of molecular and functional heterogeneity Modulation of glycosylation efficiency by mutagenesis of the consensus sequence for N-linked glycosylation Biochemistry 38,...
- 13
- 654
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... reduction equilibrium: electrochemical analysis of the alkaline form of cytochrome C J Am Chem Soc 114, 3619–3624 Tezcan FA, Winkler JR & Gray HB (1998) Effects of ligation and folding on reduction ... G, Vaccari L, Sgarra R, Viezzoli MS, Calligaris M & Randaccio L (2002) Cleavage of the iron-methionine bond in c- type cytochromes: Crystal structure of oxidized and reduced cytochrome c2 from ... slow folding in cytochrome C Acc Chem Res 31, 737–744 30 Shastry MCR, Sauder JM & Roder H (1998) Kinetic and structural analysis of submillisecond folding events in cytochrome C Acc Chem Res 31,...
- 15
- 509
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... High levels of mRNA expression were Cellular localization The cellular localization of myc-tagD14-SR was examined in transiently transfected COS-7 cells Double immuno¯uorescence analysis of cells ... excellent technical assistance This study was supported by grants from the University of Perugia, Italy REFERENCES Canonica, L. , Fiecchi, A., Galli Kienle, M., Scala, A., Galli, G., Grossi Paoletti, ... Cold Spring Harbor NY, USA 29 Chirgwin, J. M., Przybyla, A.E., MacDonald, R .J & Rutter, W .J (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease Biochemistry...
- 8
- 493
- 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... Selective detection of superoxide anion radicals J J Gao et al Scheme Synthesis of DBZTC problems were available, they would contribute greatly to the elucidation of the roles of O2–Æ in living ... solid was crystallized from a small volume of acetone cooled with dry ice, to give 14.50 g (82.39% yield) with a melting point of 130– 131 C Anal Calcd for C8 H9ClO2: C, 55.67; H, 5.25; Cl, 20.54 ... Authors Journal compilation ª 2007 FEBS 1727 Selective detection of superoxide anion radicals J J Gao et al Effect of SOD on fluorescence intensity of the reaction of DBZTC with superoxide Fig Effect...
- 9
- 401
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... applied); lane 3, 0.5 M NaCl extract (20 lL sample applied); lane 4, whole cells treated with 0.5 M NaCl (10 lL sample applied); lane 5, M NaCl extract (20 lL sample applied); lane 6, whole cells ... of heme-containing proteins by chemiluminescence Anal Biochem 209, 219–223 21 Vargas C, McEwan AG & Downie JA (1993) Detection of c- type cytochromes using enhanced chemiluminescence Anal Biochem...
- 12
- 392
- 0
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc
... ATCGGTATTTAACTAGCCCTGAAA :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC ... succocolyhpatS suerua succocolyhpatS suerua succocolyhpatS suerua succocolyhpatS suerua succocolyhpatS -673 ,33 ,5991 loiborciM nilC J swoc morf derevocer fo sisylana citeneg noitalupop raluceloM ... rof Co27 ta noisnetxe lanif dna nim rof Co49 ta noitarutaned laitinI ces 54-Co27,ces 03-Co85 ,nim 3-Co49 selcyc 03 :4 ;ces 06 -Co27,ces 06-Co06 ,ces 06-Co49 selcyc 03 :3 ;ces 06-Co27,ces 06-Co85...
- 4
- 138
- 0
Tài liệu Int’l High Performance Network Infrastructure of Korea doc
... APIITestbed/STARTAP Circumstance Int l ICT, IR, SNU-NASA Joint Forecast for Global Domain Percentage Precipitation of Climatology NASA SNU Before Correction After Correction Before Correction After Correction ... request Int l ICT, IR, 17 Renater Router (France) TEIN: Cable Network Basic Capacity of the Link was set (12/2001): SCR (Sustained Cell Rate) Mbps PCR (Peak Cell Rate) Mbps PCR can be increased ... needs of research activities Basic Capacity was re-set (03/2002): SCR (Sustained Cell Rate) 10 Mbps PCR (Peak Cell Rate) 20 Mbps Int l ICT, IR, 18 TEIN: Traffic WK08: 24 Feb - March Link capacity...
- 30
- 362
- 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot
... tolerate artificially increased levels of PMLA The data in Table allow calculation and comparison of the PMLA contents of nuclei in a variety of strains These nuclear contents vary relatively little, ... statistically highly significant The effect was structure speci c for PMLA Swelling of plasmodia or an accumulation of slime after injection could be ruled out as explanations, because concentrations ... fairly well predicted by calculation, taking into account the time elapsed after the fusion and the known length of the cell cycle The injection solution of 1–4 lL contained 15–200 mgÆmL)1 PMLA,...
- 7
- 325
- 0
Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt
... processes at the cellular level (Pelletier, 1994) Qj is the quality of prenatal and child 10 medical care available in community j We assume that technical quality changes slowly and the values ... Monckeberg 1992) Health care providers that practice high quality prenatal and child healthcare can directly influence the efficacy of the production of child health inasmuch as their practices ... a vector of family-level and individual level constraints, c is a set of constraints at the community-level, and z and p are the quality and price of all available medical care A key implication...
- 53
- 369
- 0
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx
... faecalis ATCC33186, Enterococcus faecium ATCC19434, E faecium BM4147 (VanA+, clinical isolate), E faecalis V583 (VanB+, clinical isolate) and Entero- A flounder LAAO-like antibacterial protein coccus ... (community isolate), MRSA (clinical isolates 87-7920, 87-7927, 87-7928, 87-7931 and 87-7958), Streptococcus pyogenes (clinical isolate), Streptococcus agalactiae (clinical isolate), Enterococcus ... Methicillin-resistant Staphylococcus 8.1 aureus 87-7958 Streptococcus pyogenes 5.5 Streptococcus agalactiae 2.8 Enterococcus faecalis ATCC33186 2.8 Enterococcus faecium ATCC19434 2.8 Enterococcus faecium BM4147...
- 13
- 423
- 0
The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot
... ruling class which aims directly at efficiency, a select class but necessarily self-selected, thus supplanting an economic régime by a military régime—successful truly in certain forms of economic ... is because we are careless, shiftless; because we not face the problem manfully, practice reasonable self-restraint, consider the subject in its complexity and decide upon, and carry out, a constructive ... to advance the price level If, on the other hand, the worker will save from his surplus earnings, he will increase the community's capital, and this will tend, directly or indirectly, to cause...
- 109
- 350
- 0
The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt
... 154 lampas, heaves, &c catarrh or distemper, spasmodic colic flatulent colic inflammation of bowels physicking worms bots wind-galls the fetlock cutting sprain of the coffin-joint— ringbone enlargement ... 41, 50 50 choking inflammation of stomach mange or scab horn-ail—jaundice mad-itch—bloody murrain hoof-ail loss of cud—scours or diarrhœa—warbles or grubs—wounds—puerperal or milk-fever caked bags—garget—sore ... JUDD, 41 PARK ROW AGRICULTURAL BOOK PUBLISHER 1865 Entered according to an Act of Congress in the year 1847 By RICHARD L ALLEN, In the Clerk's Office of the District Court of the United States...
- 794
- 2,692
- 0
Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx
... soil characteristics were averaged in research localities from a common forest district J FOR SCI., 57, 2011 (4): 141–152 143 Table Chemical and physicochemical properties of selected horizons (mean ... insufficient uptake of basic nutrients was also confirmed by the calculated statistically significant correlation between the foliar content of N and P and the degree of damage to underplantings caused ... correlation approaches statistical significance and confirms the results of a preceding statistical survey Contents of the majority of basic macrobioelements in topmost soil horizons (H, Ae/Ep) fluctuate...
- 12
- 529
- 0
Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf
... applied Salt can dramatically reduce plant growth The addition of NaCl caused a progressive decline in elongation of shoots of Hordeum vulgare L cv Maris Mink (cultured Barley) as well as a decrease ... Quercus robur L. , a rhythmically growing species, Trees 12 (1998) 424–430 [2] Aspinall D., Paleg L. G., Proline accumulation: physiological aspects, in: Paleg L. G., Aspinall D (Eds.), The Physiology ... Influence of proline on the growth rate of larch (Larix leptoeuropaea Dengler) embryogenic cultures in varying concentrations of NaCl Mean values ± SEM are shown very highly significant effect of...
- 4
- 338
- 0
Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps
... defoliations by phyllophagous insects We used not only current defoliation, but also an index of combined defoliation over 2-3 years This may also reveal some biological and physiological features ... insects influence wood structure in oaks Finally, the actual climate experienced by the trees, and in particular the water availability, strongly modulated the response to defoliation ACKNOWLEDGMENTS ... alone to describe annual wood increment RESULTS AND DISCUSSION The following main results were obtained from a statistical correlation analysis between crown defoliation degree and losses of...
- 6
- 263
- 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc
... et al, 1989) After each 10min period, the actinic light was switched off for to allow recording of basic fluorescence 0’ F and to compute photochemical efficiency of open PS II reaction centers ... Effects of severe dehydration on leaf photosynthesis in Quercus petraea (Matt) Liebl: photosystem II efficiency, photochemical and non photochemical fluorescence quenchings and electrolyte leakage ... m’ Lower ΔF/F in stressed individuals was m’ probably induced by low CO availability at the chloroplast level resulting from stomatal closure The decrease reveals that diversion of electron...
- 13
- 402
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25