0

key competencies of a manager

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Sức khỏe phụ nữ

... conducting a situation analysis. It is important to make the analysis manageable and practical so that activities can proceed quickly to the action planning andimplementation stage. Too many projects ... 1993). Boys are also at risk of infection and causing unwanted pregnancy. Studies inAfrica, Asia, and Latin America showed that 25–27% of young men had multiplepartners in the past year, thus ... context of the target audience.The situation analysis may involve gathering qualitative data including anecdotal informa-tion, and quantitative (numeric) data on needs and resources inside and...
  • 90
  • 469
  • 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Kỹ thuật lập trình

... DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue ... J6COM. A copy of this row is stored in a DataTable named customersDT. • There is a row in the Orders table that also has a CustomerID of J6COM. A copy of this row is stored in a DataTable named ... change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. You should...
  • 6
  • 428
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Báo cáo khoa học

... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USAStaphylococcal nuclease (SNase) is a ... folding pathway: structure-based analysis of staphylococcal nuclease. Proteins: Structure, Functionand Genetics 27, 171–183.15 Flanagan JM, Kataoka M, Fujisawa T & EngelmanDM (1993) Mutations ... Salmon testesDNA and some analytical grade chemicals such as EDTA,Tris ⁄ HCl, CaCl2, NaCl and mineral oil were obtained fromSigma (St Louis, MO, USA). Salmon testes DNA for theenzyme activity...
  • 7
  • 551
  • 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học

... and 5¢-AUAAGUAAUUUCUACGACGdTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAdTdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢(siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup-358-2)]. ... 5¢-AGCTTATCCTCGTTACAATCAAGAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIIIsites of pEGFP-NLS. The oligonucleotide fragment forNES-NLS was flanked ... dystrophy, cardiomyopathy andDunnigan-type partial lipodystrophy. J Cell Sci 114,4435–4445.13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R,Tachibana T, Hashikawa T, Imamoto F & ImamotoN (2006)...
  • 12
  • 454
  • 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học

... of substrate activation of pyruvate decarboxylase: a first approach. Eur. J. Biochem. 92, 175–181.36. Rivoal, J., Ricard, B. & Pradet, A. (1990) Purification and partialcharacterization of ... EcIPDC, a discontinuousassay based on HPLC was used [7]. To analyse the kineticbehaviour of the enzyme in more detail, a coupled opticalassay was elaborated with alcohol dehydrogenase asauxiliary ... large amounts of indole-3-acetic acid.Indolepyruvate decarboxylase, the key enzyme in thebiosynthetic pathway of indole-3-acetic acid, catalyses theformation of indole-3-acetaldehyde and carbon...
  • 10
  • 430
  • 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Kỹ năng viết tiếng Anh

... full advantage of this fact. There is a significant body of research evidence to show that learners who speak morethan one language have an increased ability to use and learn language ingeneral. ... Welsh language coordinator of a primary or specialschool and/or the appropriate head(s) of department in a secondaryschool, a member of the school’s senior management team (SMT) orthe LA advisory ... content of the writing of many learners of all abilities is often marred byinaccuracies in spelling, punctuation and grammar.• Less-able learners often make slow progress in their learning because...
  • 174
  • 616
  • 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học

... of untreated Avicel.Multivariate statistical analysis of X-ray dataThe CrI of cellulose samples was also calculated by quanti-fying the contribution of amorphous cellulose (PASC) andAvicel ... shown are the average of quadrupli-cates.Fig. 5. Effect of crystallinity (obtained from X-ray diffraction data andmultivariate statistical analysis) on the initial rate in Avicel enzymatichydrolysis ... carbon signals inNMR analysis could be obtained below a certaindegree of crystallinity and within a reasonable acquisi-tion time, so that X-ray diffraction was used as analternative to map...
  • 12
  • 554
  • 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học

... 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 43I30 3A 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ ... 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 55DKR 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ ... triple mutants.Mutant Sense Primer Antisense Primer TmR101M 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 58R103M 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢...
  • 12
  • 380
  • 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx

Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx

Báo cáo khoa học

... Biological Resources and Functions, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki,Japan2 Research Institute of Genome-based Biofactory, National Institute ... at both ends. In the case of Xgh7 4A, the active cleft is open. Although a precise anal-ysis of the mode of action of Xgh7 4A has not beenperformed, Xgh7 4A appears to be an endoglucanasebecause ... Prism (GraphPad Software, San Diego,CA, USA). One unit was defined as the amount of enzymethat released 1 lmol of glucose equivalent as reducing sug-ars from xyloglucan per minute.Analysis of substrate...
  • 7
  • 361
  • 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

Báo cáo khoa học

... motifs. Arch BiochemBiophys 342, 99–107.22 Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishi-ura S, Sasagawa N, Sorimachi N, Shimada H, TagawaK, Maruyama K, et al. (1995) Muscle-specific calpain,p94, ... Sorimachi H, Toyama-Sorimachi N, Saido TC,Kawasaki H, Sugita H, Miyasaka M, Arahata K,Ishiura S & Suzuki K (1993) Muscle-specific calpain,p94, is degraded by autolysis immediately after transla-tion, ... Kawamura Y,Kanzawa N, Nakauchi Y, Kimura S, Kawashima S &Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal musclesarcomeres: homology to neurofilament...
  • 10
  • 350
  • 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo khoa học

... (5¢-GGAGGGTGGCAGCATGTCGTTCCTTGGGG-3¢,forward),GSP 5a( 5¢-GTGGCTTCTTGAGTCATAGAATCGTGGATGAC-3¢, reverse) and GSP5b (5¢-GTGCATACAACGAAGGCAATCGAGGTCC-3¢, reverse)using MarathonTMcDNA Amplification ... & Hughes, M .A. (1994) Investigation of theactivesiteofthecyanogenicb-D-glucosidase (linamarase) fromManihot esculenta Crantz (cassava). II. Identification of Glu-198as an active site carboxylate ... wasextracted with an equal volume of EtOAc, pH of the waterphase adjusted to 8.0 with 25% ammonia and extractionwith equal volume of EtOAc repeated. The organic phaseswere evaporated and chromatographed...
  • 10
  • 650
  • 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học

... 728–733.72 Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M,Tanaka H, Yasuda H, Karin M & Kikugawa K (2003)Evidence that reactive oxygen species do not mediateNF-kappaB activation. EMBO ... vas-cular endothelial growth factor stress responseincreases the antitumor effects of ionizing radiation.Cancer Res 59, 3374–3378.101 Kanaan A, Farahani R, Douglas RM, Lamanna JC &Haddad ... enzymes that lead to extracellular matrix degra-dation (matrix metalloproteases) [75–78]. In addition,NF-jB activation was reported as an early event inmalignant transformation in vitro [79], and...
  • 12
  • 390
  • 0
Discussion paper: Key concepts of the Alternative Investment Fund Managers Directive and types of AIFM pptx

Discussion paper: Key concepts of the Alternative Investment Fund Managers Directive and types of AIFM pptx

Quỹ đầu tư

... the nature of the relationship and the responsibilities of each party. VI. Treatment of UCITS management companies 48. Article 6(2) provides that an AIFM may also act as a management company ... relevant in the application of the AIFMD, and to ensure uniform conditions of application of the AIFMD. 2. The different types of AIFM will manage a variety of AIF legal structures and a variety ... definition of AIFs in Article 4(1) (a) of the AIFMD and which may be relevant to the national competent authorities and finan-cial market participants when determining whether or not an entity falls...
  • 18
  • 379
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học

... Agrobiological Sciences (NIAS), Ibaraki, Japan3 Graduate School of Science, Nagoya University, Aichi, Japan4 Graduate School of Bioagricultural Sciences, Nagoya University, Aichi, Japan5 Chubu ... Nakagaki1,Yoshiaki Tanaka2, Akira Mizoguchi3, Toshinobu Yaginuma4and Okitsugu Yamashita4,51 Faculty of Textile Science and Technology, Shinshu University, Nagano, Japan2 National Institute of Agrobiological ... Iwami M, NagasawaH, Suzuki A & Ishizaki H (1990) Molecular cloning of the Bombyx mori prothoracicotropic hormone. Science247, 1333–1335.7 Adachi-Yamada T, Iwami M, Kataoka H, Suzuki A &Ishizaki...
  • 10
  • 437
  • 0
ENHANCING THE COMMUNICATION SKILLS OF EDUCATIONAL MANAGERS IN VINH PHUC PROVINCE: BASIS FOR A TRAINING PROGRAM

ENHANCING THE COMMUNICATION SKILLS OF EDUCATIONAL MANAGERS IN VINH PHUC PROVINCE: BASIS FOR A TRAINING PROGRAM

Thạc sĩ - Cao học

... in management, communication has the characteristics of management, but it retains its basic characteristics. Characteristics of communication in management have peculiarities, valuable management ... characteristics of communication in the management of the management staff inseparable characteristics of the object management and process management. From the above communication management ... command manager. The basic characteristics of communication in management are presented in detail, the characteristics of the management system consists of three groups: a. The management staff:...
  • 125
  • 397
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25