isolation of a galnac glycopeptide on lectin chromatography
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being investment evaluation settings Their major drawback of evaluation is that ... emphasis on value creation but it has been accused of an excessive focus on the shortterm and undervaluation of growth potential In addition, some authors argue that it is only a variant of residual ... Ittner, C.D and D.F Larcker (1998b), ``Are non-financial measures leading indicators of financial performance? An analysis of customer satisfaction’’, Journal of Management Accounting Research, 36,...
- 15
- 796
- 0
Diary of a Nursing Sister on the Western Front, 1914-1915 pptx
... bread and jam and their small share of hot tea, and blankets have just been issued We ourselves have a rug, and a ration of bread, tea, and jam; we had dinner on the station When I think of your ... has got a small French boy by him who is teaching him French with a map, a 'Matin,' and a dictionary A great deal of nodding and shaking of heads is going on Sunday, August 23rd. The same dazzling ... own ship and another We have a lot of R.E and R.F .A and A. S.C., and a great many horses and pontoons and ambulance waggons: the horses were very difficult to embark, poor dears It was an exciting...
- 98
- 617
- 0
Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx
... from an anion exchanger at a salt concentration of less than 100 mM with a yield of about 10% (Fig 3A) For a comparison the interaction of the foot-specific peroxidase with a cation exchanger, Mono ... against amino acids 20–28 of PPOD1, generated in mice (Eurogentec), used at a dilution of : 250, and visualized with an alkaline phosphatase conjugated secondary antibody (Sigma) at a dilution ... was monitored at A2 80 and fractions were assayed for peroxidase activity Grey bars indicate the active fractions pooled, subjected batchwise to cation-exchange chromatography by Mono-S and concentrated...
- 10
- 389
- 1
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... Universitat Darmstadt, Germany) was applied at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma,...
- 13
- 487
- 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx
... BPL-for, 5¢-TTCTTAACCATGG GCTTCAAAAACCTGAT-CTGG-3¢; BPL-rev, 5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BCCPD67, 5¢-GTAACCATGGGTGAACAGGAAGA A- 3¢; BCCP-rev, 5¢-GGATCCTTAAACGTTTGTGTC TATAAG-3¢; BCCP ... BPL to a final concentration of lM, and incubated at 70 °C for 30 The reaction was terminated by the addition of ice-cold trichloroacetic acid (final concentration 25% w/v), and incubation on ice ... were accumulated and spectra combined and the molecular mass determined by the MAXENT AND TRANSFORM algorithms of the MASS LYNX software (MicroMass) Assay of A aeolicus BPL BPL activity was assayed...
- 11
- 578
- 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... spectra of the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with ... changed dramatically, with a strong positive band near 192 nm and strong negative bands centered at 208 and 222 nm, which are indicative of a highly a helical conformation [22–25] The signals at 193, ... perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino protons This observation indicates that the lysine side-chains are...
- 8
- 447
- 0
development of a biosensor based on laser fabricated
... the DNA concentration of 0.5 M According to the calibration, the increased deflection indicates that the cantilever bends downward, away from the DNA-coated side (the probe DNA is coated on the ... Hagan, A K Chakraborty, and A Majumdar, Proc Natl Acad Sci U.S .A 98, 1560 (2001) G Wu, R H Datar, K M Hansen, T Thundat, R J Cote, and A Majumdar, Nat Biotechnol 19, 856 (2001) C A Savran, T P Burg, ... complementary DNA used as the target DNA is an ss-DNA with the sequence of 5ЈAGG TCT AGT GCA-3Ј A noncomplementary ss-DNA with the sequence of 5Ј-TGC ACT AGA CCT-3Ј is used as a reference The DNA used...
- 3
- 351
- 0
báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot
... Leiomyosarcoma Melanoma Ovarian carcinoma Ovarian sarcoma Pancreatic cancer Pharyngeal cancer Plasmocytoma Pleural mesotelioma Prostatic cancer Rectum carcinoma Thymic carcinoma Thyroid carcinoma Tonsillar ... components analysis (rotation: varimax with Kaiser normalisation) We used the self-regulation questionnaire as a main convergence criterion because it's two dimensional scale is measuring the adaptive ... participants Participants with malignancies had a broad range of tumour localisations (table 3) At the time of being surveyed, at least two weeks had elapsed since a participant's last operation,...
- 11
- 622
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal ... pnas.27.4.222 Bae, J-H, Park, W-G: On stability of a functional equation with n variables Nonlinear Anal TMA 64, 856–868 (2006) doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation ... Bae and Park Journal of Inequalities and Applications 2011, 2011:82 http://www.journalofinequalitiesandapplications.com/content/2011/1/82 Page of for all x, y, z, w Î X Thus, the mapping F satisfies...
- 7
- 429
- 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt
... observation indicates that the intra-dot relaxation is slower than the direct carrier capture for high power density excitation Such a fast relaxation probably occurs through a finite continuum of ... the QD transition energies in our samples Conclusion In conclusion, we have measured the rise and decay dynamics of the ground and first excited state of InAs QDs capped with an InGaAs quantum well ... upconverted with a time-delayed portion of the excitation beam in a mm thick b–barium–borate (BBO) crystal The upconverted PL light was detected by a monochromator and a cooled GaAs photomultiplier...
- 3
- 290
- 0
The effects of a RMB devaluation on ASEAN economies
... is only 8.8% for Korea TABLE Nominal Devaluation and Rates of Inflation in ASEAN and Korea, 1997-99 REGION ASEAN Nominal Devaluation CPI Inflation Real Devaluation 67.3% 0% 14.3% Indonesia Malaysia ... currency depreciation As a consequence, the real rate of depreciation for both ASEAN and Korea have been much lower In the case of ASEAN the computed average rate of real devaluation is only about 14.3% ... significant market share in textiles and apparel and other manufactures TABLE Market Share of ASEAN and China in Selected Markets (Asian Crisis Simulation Result) SECTORS USA EU JAPAN ASEAN China ASEAN...
- 20
- 305
- 0
Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx
... decomposition rate of organic matter and consequently the nitrogen mineralisation rate increases after a clear-cut 405 Several authors have described an increase in nitrogen availability after a clear-cut ... mineralisation increased Finally, Barg and Edmonds [4] found no change in mineralisation and nitrification rates after partial or total clearcut, as soil moisture, temperature and microbial biomass ... discussed later) 2.5 Statistical analysis Each year, the annual fluxes were calculated by adding up the 13 4-week incubation period fluxes As in 1993 only summer month data are available, we calculated...
- 12
- 432
- 0
Báo cáo lâm nghiệp: "Effects of a calcium deficiency on stomatal conductance and photosynthetic activity of Quercus robur seedlings grown on nutrient solution" pdf
... a decrease in A with maintenance of CO concentrations in the sub2 stomatal spaces (c and a decrease of CO ) i at the carboxylation sites (c In contrast, ) c the activation state of Rubisco was ... steady-state value of A in Ca-deficient plants was reduced to half of the control A unique linear relationship found between A and the stomatal conductance to water vapour (g at steady ) w state ... after stabilisation of stomatal conductance, the shoot was transferred to a tube containing an aqueous solution of ABA (10 M) Stomatal conductance was fol-3 lowed with a porometer (Delta-T Device,...
- 11
- 370
- 0
báo cáo khoa học: "Still too little qualitative research to shed light on results from reviews of effectiveness trials: A case study of a Cochrane review on the use of lay health workers" potx
... including a discussion of the qualitative data and the choice of quantitative outcome measures Figure Example of a qualitative study carried out alongside a randomised trial: lay health workers for families ... not available Figure Flow chart trials: qualitative data collection carried out pre-trial 14 trials: qualitative data collection carried out during or post-trial Glenton et al Implementation Science ... Cochrane review We defined a qualitative study as any study that used qualitative methods for data collection and analysis We contacted the authors of the 82 trials, asking if any such research had...
- 5
- 411
- 0
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx
... [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management of diabetes in Canada Canadian Medical Association Journal ... involving an iterative process of data reduction, data display, conclusion drawing and verification [111] Discussion Limitations An inherent limitation of collecting data through chart audit is ... D, Donaldson N: Building organizational capacity to engage in research utilization Journal of Nursing Administration 1995, 25:12-16 Tsai SL: Nurses' participation and utilization of research...
- 10
- 521
- 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx
... [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management of diabetes in Canada Canadian Medical Association Journal ... involving an iterative process of data reduction, data display, conclusion drawing and verification [111] Discussion Limitations An inherent limitation of collecting data through chart audit is ... D, Donaldson N: Building organizational capacity to engage in research utilization Journal of Nursing Administration 1995, 25:12-16 Tsai SL: Nurses' participation and utilization of research...
- 10
- 453
- 0
báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt
... Sivanandan C, Sujatha TP, Prasad AM, Resminath R, Thakara DR, Bhat SR, Srinivasan R: T-DNA tagging and characterisation of a cryptic root-specific promoter in Arabidopsis Biochim Biophys Acta ... BLASTx http://www.ncbi.nlm.nih.gov/BLAST/ programs against the GenBank database, and against a banana EST database donated by Syngenta to the Global Musa Genomics Consortium The 5'-tagged putative ... Israeli Y, Lahav E: Injuries to banana caused by adverse climate and weather In Diseases of Banana, Abacá and Enset Edited by: Jones DR Wallingford, UK: CAB International; 2000:351-379 Robinson...
- 15
- 283
- 0
Báo cáo y học: " Isolation of a new HIV-2 group in the US" pptx
... and provided valuable demographic data RG, AG, CA, and PAM amplified gag and performed the phylogenic analysis All authors read and approved the final manuscript Acknowledgements This work was ... infection is latent or that the antibody tests are false positives These data demonstrate that a pathogenic, novel strain of HIV-2 is circulating, at least, within Sierra Leone Health care providers ... 68:7433-7447 Damond F, Worobey M, Campa P, Farfara I, Colin G, Matheron S, et al.: Identification of a highly divergent HIV type and proposal for a change in HIV type classification AIDS Res Hum...
- 3
- 250
- 0
Studies on the antibody repertoire in a dengue virus immune subject and isolation of neutralizing antibodies by phage display technology
... enzymes aspartate aminotransferase and alanine aminotransferase), circulatory failure, accompanied by thrombocytopenia and haemoconcentration Complications such as gastrointestinal bleeding can also ... deepest appreciation to all the members of Vasudevan Lab for their guidance, assistance and help In particular, I would like to thank Elfin Lim, Dr Ravikumar Rajamanonmani, Dr Danny Doan, and Dr Prasad ... manifestations are characterized by high fever, bleeding, increased vascular permeability/ rapid onset of capillary leakage, liver enlargement/ damage (indicated by elevation in the levels of...
- 122
- 342
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International Medication System ... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
- 6
- 692
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ