isolation characterization and transplantation
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... GLUT1 and GLUT3 (exons 3–8), and four in human GLUT2 (exons 7–10) and GLUT4 (exons 6–9) (Table 1) The codons for arginine (96) and valine (231) in gcGLUT (Fig 2) are split between exons and 5, and ... (between exon and exon 5) and valine (between exons and exon 7) are shown Exonic regions are shown in uppercase and intronic regions are in lowercase The split codons are boxed and highlighted ... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and...
- 8
- 465
- 0
Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx
... tryptic fragments, and Dr M Aivaliotis and C Karapidaki for their contributions during the isolation and characterization of the protein RG would like to thank M Providaki, A Deli and L Spanos for ... be in the region of the gap between Ser98 and Gly102 In the N-terminal domain, there is also an additional two-stranded b-sheet (strands and 3, Figs and 5), which lies opposite the C-terminal ... 5), which is less conserved among the RIPs, and a two-stranded b-sheet and 10 (Figs and 5) In charybdin there exists an additional 310 helix (J, Figs and close to the C-terminus of the protein)...
- 9
- 424
- 0
báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt
... gene in lines 156, 49 and 111 In addition, T-DNA tandem repeats were identified in lines 156 and 49, and vector backbone sequences were integrated in lines 17, 156, 49 and 179 (data not shown) ... exposure times of up to 20 Isolation and characterization of T-DNA flanking sequences Isolation of T-DNA flanks was accomplished with Thermal Asymmetric Interlaced-PCR (TAIL-PCR) and Inverse PCR (I-PCR) ... designed and constructed the tagging vector and participated in sequence analysis SW maintained cell suspension and tissue cultures, subcultured and regenerated transgenic colonies and participated...
- 15
- 283
- 0
Isolation, cloning and characterization of the FSH beta gene promoter of the chinook salmon (oncorhynchus tshawytscha)
... (5’-GGTAGACCTTCTCGTAGGACCAC3’) and GSP3 (5’-GGTCATGTTGTTTAGTCGGCAGCCATACCT-3’) The PCR components and cycling parameters are in Table 20 and 21 except that the annealing temperature and extension time are 600C and 30s, ... putative cis-acting elements including a GSE, GnRH REs and several half androgen responsive elements (½ ARE) and EREs located contiguously between –187 and –124 bp upstream from a TATAA sequence, which ... receptors (ActRII) and two signal transducing type I receptors (ActRI; Massagué and Wotton, 2000) Upon ligand binding, the ActRII phosphorylates the ActRI on multiple serine and threonine residues...
- 142
- 361
- 0
Characterization and deactivation of sulfided red mud used as hydrogenation catalyst
... Christov and M Marshall, Fuel, 71 (1992) 449 B Klopties, W Hodek and F Bandermann, Fuel, 69 (1990) 448 K.C Pratt and V Christoverson, Fuel, 61 (1982) 460 J.J Llano, R Rosal, H Sastre and F.V Dfez, ... completely deactivated These samples, and samples of fresh unsulfided and sulfided catalyst, were characterized by nitrogen adsorption and SEM The results of textural characterization by nitrogen adsorption ... Hawkins, J.F Fryer and J.G Speight, Fuel, 59 (1980) 647 [11] T Yotono and H Marsh, in H.D Schultz (Editor), Coal Liquefaction Products: NMR Spectroscopic Characterization and Production Processes,...
- 15
- 508
- 0
Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc
... hypoxantine, guanosine and guanine, uridine and uracil, cytidine and cytosine were 12.2 and 6.2 min, 10.5 and 4.7 min, 15.2 and 6.1 min, 6.8 and 4.2 and 6.6 and 3.9 respectively The amount of purine ... employed and the elution was carried out with : 94 (v v) mixture of 95% methanol and 0.1% triuoroacetic acid in H2O The retention times of adenosine and adenine, inosine and hypoxantine, guanosine and ... A, we were able to calculate the volume of buried and surface cavities for SsCUNH and the template, both in the monomer and in the tetramer, and we found that the volume of buried cavities found...
- 15
- 557
- 0
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt
... subunit The FP band is not very clear in the agarose gel, and the longest band was used to run another PCR reaction for amplification Experimental procedures Extraction, purification and crystallization ... dyed with Coomassie blue G250, and the four bands corresponding to subunits of porcine complex II were cut out and N-terminal sequenced by the Edman degradation method and amino acid analyzer in ... modulate the interaction between membrane protein and detergent Results and Discussion The mitochondrial respiratory complex II preparation was extracted and purified from porcine heart The major purification...
- 6
- 469
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx
... (Eqn 2) On the other hand, compounds 1, 4, and are noncompetitive inhibitors, and compounds and are competitive inhibitors with respect to NADP Table summarizes the IC50 values and kinetic inhibition ... a-helix, b-sheet, b-turn, and random coil in HpSDH are, respectively, 16.6, 49.2, 1.5, and 32.6% processed by jasco secondary structure estimation software The percentage for random coil of HpSDH is ... HpSDH and the effects of pH and temperature on HpSDH The results show that HpSDH has a kcat of 7.7 ± 0.9 s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a...
- 11
- 529
- 0
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively FAD and FMN standards were used ... CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG MfeI and PstI sites were inserted in forward and reverse primers, respectively, upstream and downstream the start and the stop codons, whereas a (His)6coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...
- 13
- 439
- 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx
... and the cysteine residues alkylated in order to verify their identification Although there are standard procedures for reduction and alkylation, their application to conopeptide analysis and characterization ... course of characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification ... a-conotoxins and two disulfide bonds (identified by partial reduction and alkylation studies and MS/MS) It may also include diagnostic LC/MS for recognition of some posttranslational modifications and possibly...
- 11
- 554
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... sequence is closer to human and pufferfish (torafugu and spotted green pufferfish) IL-10 sequences Pufferfish and carp IL-10 genes, clustered together and distant from IL-20 and IL24, as recently determined ... (2003) Isolation and characterization of a novel CXC chemokine in common carp (Cyprinus carpio L.) Mol Immunol 39, 829–834 11 Fujiki, K., Shin, D.H., Nakao, M & Yano, T (2000) Molecular cloning and ... Using Parsimony ( *and Other Methods), 4th edn Sinauer Associates, Sunderland, Massachussetts 24 Laing, K.J., Holland, J., Bonilla, S., Cunningham, C & Secombes, C.J (2001) Cloning and sequencing...
- 8
- 584
- 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... aspartate residues (Asp239 and Asp260, PelB numbering), as well as the residues Asp261 and His296, believed to be of importance in the catalytic process, and Arg327 and Lys329, which may play ... 1BHE) and T maritima (small characters, derived from model based upon E carotovora 1BHE in the program 3D-PSSM) [28], for which E (e) indicates strand and H (h) helix The parallel b-strands (PB1, ... obtained from ICN (Zoetermeer, the Netherlands) Saturated oligoGalpA (DP 28) and unsaturated oligoGalpA (DP 37) were prepared and puried from polygalacturonase and pectin lyase digestions as described...
- 10
- 592
- 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... some sera to a 9- and a 15-kDa band We could show that the 9-kDa band in the tomato extracts reacts with a specific antibody against the LTP from cherry, Pru av and the 15-kDa band shows reactivity ... N-linked oligosaccharides and is present in a wide variety of plant extracts Glycobiology 8, 651–661 25 Vieths, S., Janek, K., Aulepp, H & Petersen, A (1995) Isolation and characterization of the ... Karlsruhe, Germany) and proteins were separated by SDS/ PAGE using a 10% resolving gel with 1.5-mm spacers Desired bands were excised from the gel after staining with 0.3 M CuCl2 and the protein...
- 11
- 533
- 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... cm)1 and ms (PO2–) at 1120 cm)1, respectively [23,30], and the bands at Fig Infrared spectrum in the spectral range 1800–900 cm)1 (A) and – in the range of the negatively charged phosphate band ... by treatment with DNAse/RNAse and proteinase K, and lyophilized and used in the natural salt form The lipopeptide palmitoyl-3-cysteine-serine-lysine-4 (Pam3CSK4) and the macrophage-activating ... hydrated PC, MfGl-II, and LPS Re 1172, 1085, and 1038 cm)1 assigned to glucose ring vibrations [31] As no additional bands in the range of the amide vibrations centered at 1650 and 1550 cm)1 can...
- 9
- 665
- 1
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... Asn117, Tyr287 and Arg311), and the two Cys residues (105 and 186) that form a disulfide bond between EL1 and EL2 to maintain the receptor in a high affinity conformational state Several Ser and Thr residues ... positions (3 and 10), while xTRHR2 had these sites at positions and 12 The glycosylation site in EL2 (Asn167 for xTRHR1 and Asn172 for xTRHR2) and the two homologous Cys residues (335 and 337 for ... intestine (lane 10) and dorsal skin (lane 11) Rat testis (lane 1) and ovary (lane 2) were used as positive and negative controls, respectively TM7 (in Xenopus and mouse TRHR1) [41] Tyr106 and Asn110 have...
- 11
- 506
- 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx
... the cytosolic and membrane-bound forms of yeast PtdEtn-PLD and examined the regulation of PtdEtn-PLD activity under certain growth, nutritional and stress conditions MATERIALS AND METHODS Chemicals ... (I+) and/ or mM choline (C+) Other amino acidrich media included: YPD [yeast extract and Bactopeptone (YP) containing 2% dextrose]; YPA (YP containing 0.05% glucose and 2% potassium acetate); and ... 2002 Characterization and regulation of yeast PtdEtn-PLD activity (Eur J Biochem 269) 3823 Table Effect of different divalent cations on cytosolic and membranebound PtdEtn-PLD activity Cytosolic and...
- 10
- 499
- 0
Báo cáo khoa học: Thiaminylated adenine nucleotides Chemical synthesis, structural characterization and natural occurrence potx
... probe and a simple pulseacquire sequence (30° pulses for 1H and 31P and 90° pulse for 13C) Several 2D spectra were also recorded using standard Bruker parameters NMR data for ThDP, AThDP, ThTP and ... 500 ⁄ 125 ⁄ 202.5 MHz in D2O at pH 7.4 and 25 °C TMS and H3PO4 were used as references ThDP was a commercial preparation (Sigma-Aldrich), and ThTP, AThDP and AThTP were synthesized as described ... and m ⁄ z 257.1 We were unable to assign the latter ion, which is obtained after fragmentation of both AThTP and AThDP and probably results from a molecular rearrangement NMR data for AThTP and...
- 13
- 297
- 0
Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt
... cell lysates (C) and 50 lL of medium (M) of HT1080 and HT1080-Scpep1 were separated by SDS-PAGE, blotted and probed with the a-His antibody and the a-Scpep1 antisera from rabbit and rat, respectively ... high transcript levels in kidney and aorta in rat and lower levels in heart, spleen and lung, whereas the human transcript was detected strongly in the kidney and heart but at a low level in a ... transferase) and urine parameters showed no pathological findings The activities of several lysosomal hydrolases were normal in various tissues and lysosomes from liver and kidney of Scpep1-gt mice, and...
- 14
- 362
- 0
Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx
... homogeneity and characterized We also provide evidence that amiclenomycin and a new analogue irreversibly inactivate M tuberculosis DAPA AT Results and Discussion Cloning, expression and purication ... described above, and by varying AdoMet and KAPA concentrations The inhibition type and the inhibition constant displayed by KAPA were determined using the HanesWoolf plot Vm and KmAdoMet were ... antibiotics and herbicides Indeed, this metabolic pathway is specic to micro-organisms and higher plants [2] Two antibiotics isolated from Streptomyces species, actithiazic acid [3] and amiclenomycin...
- 12
- 490
- 0
Báo cáo khoa học: Human recombinant prolidase from eukaryotic and prokaryotic sources Expression, purification, characterization and long-term stability studies pptx
... endogenous enzyme and the tagged and untagged recombinant prolidase was close to the activity measured on day (123%, 90% and 85%, respectively) This paper describes the purification and characterization ... Here we describe the synthesis, purification and biochemical characterization of human recombinant prolidase from eukaryotic and prokaryotic hosts and compare the enzyme with the endogenous prolidase ... similarity of the recombinant and endogenous prolidase in terms of substrate specificity, optimal pH and temperature for activity, and metal dependence is discussed, and a detailed analysis of long-term...
- 13
- 227
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008