is there a way to measure the implementation of integration in different countries
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... more clinical and statistical cohesive set together rather than existing as separate scales For the same reasons, three domains (physical comfort, technical aspects of care, coordination of care) ... could also be generated that could discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also ... study including the design and coordination All authors contributed to the interpretation of data and writing of the manuscript All authors read and approved the final manuscript Competing interests...
- 8
- 492
- 0
Báo cáo y học: " Inflammation: a way to understanding the evolution of portal hypertension" ppsx
... hypoproteinemia and hypoalbuminemia The inflammatory nature of these alterations can be hypothesized, since the oral administration of budesonide prevents these early exudative changes [66] The acute inflammatory ... lymphatic vessels but are most prominent immediately beneath the epithelial surface of the skin and in the mucosa of the genitourinary, respiratory and gastrointestinal tracts, the latter having ... also act in the vascular endothelium as a stress stimuli, generating a inflammatory response [63] If it is considered, in the case of portal hypertension, that there is an endothelial inflammatory...
- 25
- 313
- 0
The US econom is there a way out of the woods
... implies a change in the net stock of overseas assets, and the private balance implies a change in net private wealth As there is a limit to the extent to which stocks of debt can be allowed to rise ... balances must always sum to exactly zero, no single balance is more a residual than either of the other two Each balance has a life of its own, and it is the level of real output that, with minor ... rise relative to GDP, there is a corresponding limit to the extent to which the financial balances can (be allowed to) fluctuate, implying that the ratios of stocks to GDP have norms that can sometimes...
- 11
- 198
- 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... behaviour in the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being investment evaluation settings Their major drawback of evaluation ... the amount of relationships since firms have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to...
- 15
- 796
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... day To this, an internationalization strategy was adopted with the aim of expanding sales in countries such as Germany, France and the UK This phase saw the obtaining of specific improvements in ... with a very open vision of work and a certain tolerance of mistakes One of the main factors explaining the culture of the firm is its belonging to the MCC, which is composed of a set of co-operatives ... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was...
- 10
- 1,063
- 1
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and ... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... surprising since the levels of MMP-9 in SF have been shown to vary according to several factors, such as the disease state, the local concentration of inflammatory cytokines, and the number of infiltrating...
- 10
- 494
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... existing guidelines for monitoring the physical health of adults with SMI [33] Training topics include ascertainment of CVD risk factors; monitoring these risk factors in an SMI population; learning ... (ATLAS.ti Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All ... estimated rate to assess the precision that can be achieved by the proposed sample size Margin of error is half the width of a confidence interval of an estimator The smaller the margin of error, the...
- 12
- 423
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... it is in fact a complex process involving many individuals The tool itself is organized into four general areas of assessment Acquire: can your organization find and obtain the research findings ... while maintaining consistent terminology and meanings The organizational response rate was low This was due to several factors, including the short time frame available for the study and competing ... central interest to them Nevertheless, there was a strong feeling among these participants that the tool generated a lot of useful discussion because it raised awareness of what to consider in using...
- 9
- 506
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... it is in fact a complex process involving many individuals The tool itself is organized into four general areas of assessment Acquire: can your organization find and obtain the research findings ... while maintaining consistent terminology and meanings The organizational response rate was low This was due to several factors, including the short time frame available for the study and competing ... central interest to them Nevertheless, there was a strong feeling among these participants that the tool generated a lot of useful discussion because it raised awareness of what to consider in using...
- 9
- 412
- 0
Báo cáo y học: " Is there a linear relationship between the Brief Psychiatric Rating Scale and the Clinical Global Impression-Schizophrenia scale? " doc
... and the CGISCH and in the further improvement of the BPRS as a diagnostic scale Acknowledgements The authors wish to acknowledge Katsuji Nishimura, Takao Kanai, Ken Inada and Kaoru Sakamoto for ... and evaluating the results of the statistical analysis In addition, all authors read and approved the final version of the manuscript Competing interests The authors declare that they have no ... list of symptoms The quality of the clinical chart is notoriously variable, so there may exist errors and distortions from missing symptoms and falsely rating symptoms as absent when reviewing...
- 10
- 331
- 0
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... physiological and management factors [2], e.g milking frequency, and it is reasonable to assume that the SCC peaks after a stop in an AMS are related to changed conditions in the udder due to the PMI The ... h All other analyses and preparations of smears for PMN counting were performed within h Statistical analysis Data of milk SCC, PMN, fat, protein and lactose were used in the statistical calculations ... casein and FFA which were analyzed in afternoon milk only, the total output per milking was used The data were analyzed using the Mixed procedure with repeated measure ANOVA (Analysis of Variance)...
- 10
- 397
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... Achieving brand awareness Aaker (1991) prescribed some of the following factors as ways to achieve brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can ... measurement of brand equity because of the necessity in today’s marketplace to develop, maintain and use product branding to acquire a certain level of competitive advantage According to Ailawadi ... restaurants, but attaining this objective is not always an easy task due to the fact that the products and services of many fast food restaurants are similar and their means of distributions are...
- 88
- 986
- 8
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... result in equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study ... Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may benefit from the way in which the las operon is...
- 12
- 616
- 0
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx
... coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ED performed data cleaning and data analysis SM contributed to data analysis, writing of ... research provides valuable quantitative information demonstrating the critical role that Indian generic pharmaceutical manufacturers play in the global treatment of HIV/AIDS in developing countries ... obligations for India can increase ARV prices, impede the development of acceptable dosage forms, and delay access to newer and better ARVs Such measures can undermine the international goal to achieve...
- 9
- 283
- 0
Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt
... method Angiotensin I and II were measured with a rat angiotensin I and II EIA kits (Phoenix Pharmaceuticals, USA) according to the manufacturer’s instructions Urine was assayed for creatinine by a ... once per week at the same time during the day After the stabilization of the animals in o a warm box at 37 C for 15 min, the tail systolic blood pressure was measured with a non-invasive blood ... product in protein metabolism and is excreted in the urine via the kidney, the BUN level is important in the evaluation of renal function Although urinary creatinine unexpectedly increased in control...
- 6
- 406
- 1
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... prognostic value as there is a direct statistical association with the development of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative ... carcinomas [9] But the labelling index of cyclin D1 correlated with the pathological stage of the disease in invasive lobular carcinomas but not in invasive ductal carcinomas Another study evaluated ... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association...
- 9
- 423
- 0
Báo cáo y học: "A randomized, double-blind, placebo-controlled trial to assess the efficacy of topiramate in the treatment of post-traumatic stress disorder" pot
... much of the research associate the glutamatergic systems with learning and memory; the GABAergic (γaminobutyric acid) system in the basolateral amygdala, is also involved in the acquisition and ... in mice is associated with a reduction of extracellular GABA levels in the amygdala indicative of a reduced GABA release and/or increased GABA uptake from the extracellular space Clinical studies ... show that AMPA antagonists attenuate acoustic startle response when administered into the amygdala For instance, Khan and Liberzon [20] demonstrated that topiramate reduced significantly the acoustic...
- 7
- 588
- 0
Báo cáo y học: "Alternative way to test the efficacy of swine FMD vaccines: measurement of pigs median infected dose (PID50) and regulation of live virus challenge dose" docx
... used as the challenge strain, but a large amount of the materials was limited to obtain The suckling mice passaged virus was used here as challenge strain to solve the problem Comparatively, the ... post vaccination) and 28 dpv to assay the antibody against FMDV serotype O using a standard LPB-ELISA (Liquid phase blocking-ELISA) Table Data for calculating PID50 Virus dilution Number of pigs ... 50 was calculated according to Karber method The experiment was repeated for the dilutions 10-5 to 10-8 The PID50 was calculated to be 6.5 The data were shown in Table The repeated data were the...
- 3
- 306
- 0
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... linkage analysis in complex human diseases has seen a shift in emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association ... determination of asthma and associated traits is very large [11,12] There is now an extensive and growing list of candidate genes investigated with regard to traits associated with asthma and atopy ... Several useful SNP databases are available on the World Wide Web (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible...
- 11
- 491
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008