is there a role of hrt in the primary prevention of chd
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx
... lymphomas, one of the important roles of FNAC is the exclusion of metastatic squamous carcinoma as this requires an alternative therapeutic approach There is a question as to the accuracy of FNAC in ... incidence in Wales with a ratio of 1:4 [1] Table 1: Anatomical location of lymphomatous lymph nodes (n = 62) Anatomical location Number of cases Cervical Inguinal Axillary Intra-abdominal Supraclavicular ... in the diagnosis of lymphomas as the tumours often contain malignant and reactive elements and the FNAC may only have sampled the reactive regions leading to false negative results Another disadvantage...
- 4
- 435
- 0
Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx
... Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and two had liver metastasis One patient had mediastinal involvement ... seventh rib Any relapse involving the axillary lymph nodes, and/or other nodes in the infra or supraclavicular fossa or in the internal mammary chain was considered as a regional recurrence Any recurrence ... an advanced primary tumor At this time, the role of PMRT for women with to positive lymph nodes remains uncertain and is being examined in a randomized clinical trial” Many surgeons and radiation...
- 8
- 357
- 0
Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt
... hemorrhage Administration of FVIIa is certainly warranted in this patient Life-threatening hemorrhage and coagulopathy in critical care patients carries significant morbidity and mortality, with increased ... Administration MedWatch database [10] described 151 complications associated with off-label use of FVIIa, the majority occurring in trauma patients However, MedWatch is a database for voluntary ... of acidosis, hypothermia, and subsequent additional coagulopathy — is likely to be more efficacious The risk for adverse events after FVIIa administration is low, and in this case, although the...
- 4
- 304
- 0
báo cáo hóa học: "Impact of gastroesophageal reflux disease on patients'''' daily lives: a European observational study in the primary care setting" doc
... sensitive quantification of the symptoms and the impact of these in patients with GERD, and thereby facilitating better management of disease Conclusion The findings of this European observational study ... from AstraZeneca; Dr J Zapardiel is an employee of AstraZeneca 10 11 12 Authors' contributions All authors were involved in data interpretation and manuscript preparation Data analysis was provided ... in the primary care setting, tailoring treatment on an individual basis in order to lessen the impact of the disease This may be aided with the use of well suited, validated PRO instruments Page...
- 8
- 521
- 0
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
... programme in the administration of manualized EPC and SEC from PD who is an accredited clinical psychologist with national expertise in training clinicians in psychological interventions The therapists ... that only half of the initial sample had injected in the last month at baseline, would suggest a broad treatment effect i.e injecting behaviour had already stopped in half of the participants at ... sero-conversion, which is not open to bias, and in addition majority of the interview measures were direct and quantitative rather than subjective and qualitative Statistical Analyses Data analysis was conducted...
- 12
- 454
- 0
Báo cáo khoa học: "Bench-to-bedside review: Is there a place for epinephrine in septic shock" pptx
... correlating an increase in MAP with an increase in cardiac index [6] Using epinephrine as a first line agent, Moran et al [7] reported a linear relationship between epinephrine dosage and heart rate, ... epinephrine and propranolol also act on hemodynamics Therefore, alterations in the serum concentrations of catecholamine may affect the immunocompetence of the organism and may thereby affect the clinical ... in epinephrinetreated animals Furthermore, these immunological alterations were accompanied by a significant increase of sepsisinduced mortality Co-administration of propranolol and epinephrine...
- 5
- 278
- 0
Báo cáo y học: "Is there a dysfunction in the visual system of depressed patients" pptx
... which is a method with which one can study the electrical and metabolic activity of the outer layers of the retina During the adaptation of the retina to dark, the amplitude of the EOG gradually ... the light peak is related to the pre-adaptation level of the retina, while the dark trough is stable after only minutes in dark Generally, the standing potential of the eye manifests a diurnal ... metabolic activity of the outer layers of the retina The fall of a light stimuli on the retina produces early and late potentials The method of recording late potentials is the Electroretinogram (ERG)...
- 10
- 484
- 0
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot
... rheumatoid arthritis [72] Podiatry is part of the multidisciplinary team Podiatry is part of the multidisciplinary team Full-time dedicated podiatrist specialising in rheumatology is essential ... biological therapies However, despite these advances evidence indicates that active disease in the foot is an ongoing problem in clinical practice A new paradigm of podiatry care can adopt these advancements ... JS, Aletaha D: Developments in the clinical understanding of rheumatoid arthritis Arthritis Res Ther 2009, 11:204 Aletaha D, Huizinga TW: The use of data from early arthritis clinics for clinical...
- 10
- 383
- 0
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... for analysis of casein and FFA were collected in the afternoon milkings, at days -1 and from all cows At days and casein and FFA was analysed in milk only from cows which during day had a pronounced ... All other analyses and preparations of smears for PMN counting were performed within h Statistical analysis Data of milk SCC, PMN, fat, protein and lactose were used in the statistical calculations ... draft and revise the manuscript EW participated in the practical work of the study, was main responsible for performing the statistical analyses, helped in interpreting the results and revising...
- 10
- 397
- 0
Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx
... groups The number of days of acute lung injury was decreased, however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting ... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... demonstrated that the administration of NAC decreased nuclear factor-κB activation associated with decreases in IL-8 in septic patients [19] In a previous multicenter clinical trial in patients...
- 3
- 469
- 0
Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt
... were maintained in a hypoxia chamber (Invivo 400; Ruskinn Inc., Cincinnati, OH, USA) constantly maintained at 1% O2 Culture medium was replaced every other day inside the chamber For miRNA transfection, ... described in (A) Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis The data shown are mean value ± standard errors of the mean from three independent ... incubator with 21% O2 The normoxia data are the same as shown in Fig and are included here for comparison Expression of miR-2 7a and miR-27b at the indicated time points was assessed by quantitative...
- 11
- 848
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... protein that is degraded via the ubiquitin ⁄ proteasome pathway TNSALP (D289V), which is associated perinatal hypophosphatasia, is another example [14] These findings suggest that the biosynthesis ... alkaline phosphatase gene in Japanese patients with hypophosphatasia J Bone Miner Metab 20, 28–33 Sawai H, Kanazawa N, Tsukahara Y, Koike K, Udagawa H, Koyama K & Mornet E (2003) Severe perinatal...
- 14
- 445
- 0
Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt
... [1] The L-chains in the majority of elementary units may interact noncovalently with the oligosaccharide chains of fhx/P25 or act as structural barriers and cause protection of the terminal mannose ... unit of fibroin, having the same molar ratio of H- and L-chains, and fhx/P25 as of the elementary unit present in the PSG extract, could be isolated from the ER extract of PSG cells of a normal-level ... L-chain fhx/P25 A role of L-chain in the protection of a1 ,2-mannose residues of the N-linked oligosaccharide chains of fhx/P25 in the elementary unit The PSG cell extract of Nd-sD mutant was subjected...
- 11
- 552
- 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc
... circulating medium to facilitate this new branch of traffic As a natural consequence of the issue of all this paper the coin was rapidly leaving the kingdom; this circumstance alarmed the managers ... was necessary to raise the standard of the coin, or to lower the value of the paper It was in vain that Mr Law protested against this advice, and appealed to the promise borne upon the notes An ... Bank was saved, as always happens in such cases, by the ruin of individuals The sudden contraction of its loans increased the general pressure and alarm; and the list of private failures was almost...
- 78
- 775
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... the valienamine ring in AMY2/acarbose (Fig 1A) Superpositioning of AMY2 and TAA guided by the catalytic acids was excellent for Tyr51AMY2 and Tyr82TAA (Fig 1A) and mutation in Saccharomycopsis ... conserved in plant a- amylases, has a role in substrate binding and activity This local region was different in structures of nonplant a- amylases having a longer ba loop which typically contained aromatic...
- 14
- 557
- 0
Báo cáo khoa học: "the Role of Non-Timber Forest Products (NTFPs) in Livelihood Strategies and Household Economies in a Remote Upland Village in the Upper Ca River Basin, Nghe An, Vietnam" pdf
... medical stations nearby, these are the main source of medicine in the hamlet A diverse array of medicinal plants is gathered year round, and most households also used medicinal plants to purify daily ... growing cassava lasted long and this allowed its tuber to attain a large size Areas of swidden rice, maize and cassava were calculated from the number of kilograms of planted rice, planted maize ... research was conducted in Tha Lang, a poor hamlet in Bao Thang Commune, Ky Son District, Nghe An Province The hamlet was located in a valley in the Ca River Basin (CRB), at an altitude of 230m above...
- 11
- 390
- 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 ... FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 VIC- TCGGGAGTTCGAGACC-MGB SNP5R ACACAGGGTTTCACCATGCT SNP5 allele2 FAM- CGGGAGTTGGAGACC-MGB SNP6F TCCCTACTGTTGTTTCCGCC SNP6 allele1VIC-TGAAGACCCTGGGC-MGB...
- 9
- 559
- 0
Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf
... CAGCTTTAAGGCCGGCTGTTATACCG PygfZk226AR pQE-Rv_0811c CGGTATAACAGCCGGCCTTAAAGCTG PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC PygfZG227AR pQE-ygfZK22 6A GTCCGGTATAACAGGCTTTCTTAAAG pQE-ygfZG22 7A PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG ... CTTTAAGAAAGGGGCTTATACCGGACAAG PygfZC228AR CTTGTCCGGTATAAGCCCCTTTCTTAAAG PygfZC228SF CTTTAAGAAAGGCTCGTATACCGGAC PygfZC228SR CTTTAAGAAAGGCATGTATACCGGAC PygfZC228MR pQE-ygfZC228S GTCCGGTATACGAGCCTTTCTTAAAG PygfZC228MF ... pQE-ygfZC22 8A GTCCGGTATACATGCCTTTCTTAAAG PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA PygfZT230AF AAGGCTGTTATGCCGGACAAGAGATG PygfZT230AR pQE-ygfZC228M pQE-ygfZY22 9A CATCTCTTGTCCGGCATAACAGCCTT...
- 13
- 440
- 0
Báo cáo y học: " The L76V mutation in HIV-1 protease is potentially associated with hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a clinical advantage" potx
... intellectual contribution to the study including acquisition-, analysis- and interpretation of data and finally drafting the manuscript JV assisted as consultant in patient-specific aspects and ... Nevertheless, since there are still distinct discrepancies, mostly overestimation of resistance, in the prediction of the resistance level for Atazanavir and Saquinavir in five of the most common ... and white colour) A) One patient with failing APV containing therapy after week 72 B) Another patient with a failing IDV/LPV treatment before start of SQV containing therapy Wiesmann et al AIDS...
- 9
- 434
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25