intraradicular blood flow analysis under the tension of nerve root induced by lumbar disc herniation
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... the fuel cell relies on the ambient relative humidity and water production in the cathode for the humidification of the membrane; (x.) the circulating ambient air facilitates the cooling of the ... well as the amount of liquid water present to the amount of water undergoing phase change In the present work, the procedure of Berning and Djilali [15] was used to account for the magnitude of phase ... [W/m2] and the specific surface area [m2/m3] of the porous medium [17] Hence, the unit of β is [W/m3] The gas phase and the liquid phase are assumed to be in thermodynamic equilibrium, i.e., the liquid...
- 16
- 727
- 0
Tài liệu MARKETING PLACES- CONCEPTS ABOUT A PLACE UNDER THE PERSPECTIVE OF MARKETING PLACES pdf
... experts of the place Measure the perseptions of the audience, find out the impresive features of the place on customers Session 10: Promote development of a place 38 19 c What elements can guide the ... " 25 Customers the critical element determining all development objectives of the plae: - Interests of the customers should be of priority, unique, and separate - Interests of the place will ... development plan under implementation The image of a place may change under the impacts of internal and external factors - Session 10: Promote development of a place 37 b How to measure the image May...
- 32
- 513
- 0
Tài liệu Báo cáo khoa học: "An Information-Theory-Based Feature Type Analysis for the Modelling of Statistical Parsing" docx
... 1.6808 0.6612 Y= the first right brother of the current node 0.4730 1.1525 0.7502 Y= the first left brother of the current node 0.5832 2.1511 1.2186 Y= the second right brother of the current node ... 0.5044 0.2525 Y= the second left brother of the current node 0.0949 0.6171 0.2697 Y= the first right brother of the parent 0.1068 0.3717 0.2133 Y= the first left brother of the parent 0.2505 ... (Y= the parent) (Y= the first left brother) (Y= the first left brother of the parent) 0.4730 (Y= the first right brother) SD=2 0.6483 0.0949 0.1068 (Y= the grandpa) (Y= the second left brother)...
- 8
- 503
- 0
ISSUED UNDER THE AUTHORITY OF DIRECTOR-GENERAL OF POSTS, INDIA AND SECRETARY TO GOVERNMENT OF INDIA DEPARTMENT OF POST MINISTRY OF COMMUNICATIONS & INFORMATION TECHNOLOGY pdf
... on the death of holder thereof and before the maturity of the certificate, or before the certificate having reached maturity has been discharged, the nominee shall on the death of the holder of ... of the Post Office Savings Bank where the account stands for payment of the amount due on the account to the Commanding Officer or the Committee of Adjustment; and the Officer incharge of the ... nominated by him for the purpose The minor One on behalf The guardian of each minor during the minority of the minor and thereafter the ex-minor One on behalf The guardian of each person of unsound The...
- 165
- 501
- 0
Hygeia, a City of Health, by Benjamin Ward Richardson This eBook give it away or re-use it under the terms of the Project Gutenb doc
... placed in the sarcophagus of those sons of men who were accounted the heroes of the infantile life of the human world We discover, moreover, from our view of the past, that the developments of tenacity ... from the firegrates of the house The bricks intended for the inside walls of the house, those which form the walls of the rooms, are glazed in different colours, according to the taste of the ... persons of different stages of civilisation to the test of his gauge, and discovered that the strength of the limbs of the natives of Van Diemen's Land and New Holland was as 50 degrees of power,...
- 116
- 376
- 0
Manhood Perfectly Restored, by Unknown This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg pptx
... Injury to the Urine Canal from the rough use of sounds, bougies, catheters, &c., &c Any one or all of these, by extending the inflammation backward to the seminal ducts and neck of the bladder, ... honor, honesty and fair dealing of the Agency We court the fullest and freest investigation, either by patients themselves or any friends of theirs in this city, either of whom we shall be happy to ... water on the brain, with Lasting rickets and softening of the bones—idiots or imbeciles— dying early and scarcely regretted even by the parent whose progeny they are, for every wail of the little...
- 371
- 1,077
- 0
Outlines of Greek and Roman Medicine, by James Sands Elliott This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of docx
... consequence of the strange happening of the serpent landing from the ship the end of the island on which the Temple of Æsculapius stood was shaped into the form of the bow of a ship, and the serpent of ... Roman Medicine at the end of the Republic and the Beginning of the Empire Asclepiades of Prusa Themison of Laodicea Methodism Wounds of Julius Cæsar Systems of Philosophy State of the country Roman ... was formed of three tiers of arches, the vault within the innermost tier being 14 ft in diameter The administration of the sewers, in the time of the Republic, was in the hands of the censors,...
- 425
- 659
- 0
An analysis on the effectiveness of conversion in daily conversations Focus on English - major students at Hai Phong Private University
... part of speech being used in the function of another…is testified by the fact that these new denominal verbs fully acquire all the grammatical categories‖ be longing to the new part of speech the ... the name of human body, the verb generally denotes an action performed by it E.g hand (n) – to hand Eye – to eye 1.3.4 Name of professions: The noun is the name of profession or occupation, the ... Partial Substantivation: is the formation of nouns from adjectives with the help of the article the E.g.: the rich, the blind, the young Those words have the properties of both nouns and adjectives...
- 51
- 729
- 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx
... cord—Treatment after the cord falls off—A pouting navel —Bathing baby—Clothing the baby— Baby's night clothes—Care of the eyes —Care of the mouth and first teeth— Care of the skin—Care of the genital ... miscarriage The tendency to miscarriage Page 187 The Baby CHAPTER XVI HYGIENE AND DEVELOPMENT OF THE BABY What to prepare for the coming baby— Care of the newly-born baby The first bath—Dressing the ... reproductive organs at puberty The female generative organs The function of the reproductive organs The age of puberty in the female The function of the ovary The function of the womb—Why menstruation...
- 634
- 1,044
- 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot
... on the proteomic data is considerably reduced by the presence of contaminants derived from other subcellular structures, as well as by the Ôresolution of the studyÕ which is determined by the ... foreign material by macrophages In this analysis, in addition to the description of the phagosome proteome, the maturation of the organelle was monitored by comparative analysis of phagosomes in ... signal -induced entrance of the protein TCP-1a into the nucleus as well as translocation of nuclear annexin IV from the nucleus to the cytosol, as deduced from the comparative analysis of the protein...
- 11
- 493
- 0
The Healthy Life, Vol. V, Nos. 24-28, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg L ppt
... other means of getting over the fire Sometimes the bough of a tree high out of the reach of the flames will Sometimes a stick or oar thrust into the bank or in a crevice of the wall behind the fire ... then fits on the outer one and the two other lids have to be carried separately The Five-Foot Sausage You hang these camp-kettles over the fire by their bucket handles, from the tripod or other ... now that you fix the V point of a pair of braces somewhere near the top of the sack and bringing the webs over your shoulders, fix them, nicely adjusted, to the lower corners of the sack, it will...
- 815
- 2,061
- 0
classical microlocal analysis in the space of hyperfunctions
... A P r o o f s of product f o r m u l a e A.1 A.2 A.3 A.4 A.5 Proof Proof Proof Proof Proof of of of of of Theorem Corollary Theorem Corollary Theorem 2.4.4 2.4.5 2.4.6 2.4.7 ... short introduction to the theory of hyperfunctions The other is Treves' book [Tr2] Treves developed in [Tr2] the theory of analytic pseudodifferential operators in the framework of distributions, ... and is a unique solution of (1.8) By the same argument as in the proof of Proposition 1.2.6, we have Ul E A'(K[) Moreover, applying the same argument as in the proof of Proposition 1.2.6, we...
- 372
- 223
- 0
regional business cycle and real estate cycle analysis and the role of federal governments in regional stability
... formation of the business cycle patterns of the formar group of states The business cycle patterns of the major oil supply states are distinctly different from the national business cycle patterns The ... proximity from the economically dominant states plays quite a signi cant role in the formation of the business cycle patterns of the former group of states The business cycle patterns of the major ... cycle patterns In face, most of the time the state level business cycles of this group lay on the opposite side of the national business cycle.Most of the states fall into the fourth category where...
- 120
- 418
- 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... Determination of the level of RNA products of the H19 gene The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse primers using 0.05 units/μl of ... Luc -H19 or the LucSV40 plasmid The values represent the luciferase activity of the H19 promoter relative to the activity of the control vector LucSV40 B The killing potential of the DTA-H19 ... treatments (P < 0.05) Discussion The present work shows the use of the regulatory sequences of the H19 gene for the development of DNAbased therapy for human ovarian cancer related ascites The successful...
- 11
- 559
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon and the 5’ end of exon without the introns in between The integrity of the cDNA was assayed by PCR analysis of the ubiquitous, cell cycle independent, ... examined by ISH and the expression levels of IGF2-P4 and H19 transcripts were determined by the intensity of the hybridization signal and by the quantity of the stained cells Table shows that out of ... reflected by measuring the size of the tumors and by bladders weight Tumor area of each bladder was macroscopically determined, using the ImagePro Plus software for measurement and analysis of the...
- 18
- 746
- 0
báo cáo hóa học: " Clinical implications of gait analysis in the rehabilitation of adult patients with "Prader-Willi" Syndrome: a cross-sectional comparative study ("Prader-Willi" Syndrome vs matched obese patients and healthy subjects)" docx
... phase, that is likely due to the excessive load that the knee must support during the stance phase In normal gait the load of the body is supported by the muscle activity of the leg, but in an overweight ... to the presence of excessive adipose tissue inside the thighs, as previously suggested [5] and to the presence of flat foot due to the overload Recent studies of the load distribution on the ... Taken into consideration the peculiar clinical picture of patients with PWS, aim of our study was to characterize the gait pattern of these subjects by using 3D-Gait Analysis The results were compared...
- 7
- 531
- 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx
... from the most important food merchandise distribution center in the city The samplers were located on the roof of a four-story building the time of the experiment; none were smokers On the morning ... concentration of 25 mM This solution was stored in the dark at 4°C On the morning of the experiment, ml of this solution were added to the sample to give a final concentration of 100 mM The CL response ... vitro Generation of ROS by Neutrophils The in vitro generation of ROS was measured by luminolenhanced chemiluminescence (CL) and expressed as the area under the curve (AUC) The CL AUC from NHV...
- 11
- 511
- 0
Báo cáo hóa học: " Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models" pptx
... sensitivity to the system output and then which of the parameters are linearly independent The method iterates over the columns of the sensitivity matrix Z to select the column with the highest sum of squared ... sensitivity To make the adjustment of the net influence of each of the remaining parameters on the already selected parameters, all of the original columns of Z are being regressed on the column associated ... based on the model structure and the measurement data One of the benefits in integrating estimation and identifiability is the reuse of the variance generated by the UKF for the step size in the calculation...
- 8
- 381
- 0
Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps
... stenosis, the area under the ROC curve was calculated to be 0.843 [0.802-0.884] The coordinates of the curve indicated that the cut-off of 4.0 (as pre-defined by the manufacturer) provided the best ... systems In the case of the heart, analysis is performed on the signals emitted by the heart, such as the surface resting electrical signal recorded by an ECG 260 In systems analysis, the ECG signals ... Coherence is expressed as the amplitude ratio of the two leads squared for each frequency; the result is a measure of the correspondence of the output energy of the two leads The coherence function...
- 15
- 456
- 0
Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc
... Materials The study was approved by the local institutional committee on human research Written informed consent was waived by each participant as a result of the disclosed non-risk designation of the ... order to assess the performance of the prediction of stenosis independent of the prevalence of stenosis the positive and negative likelihood ratios (LR) were calculated [24] A value of P < 0.05 was ... indicated that a cut-off of 4.0 provided the best combination of sensitivity and specificity for the prediction of coronary stenosis from the 3DMP test (as was pre-defined by the manufacturer) 12,00...
- 12
- 418
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25