influence of endothelial cell seeding with microvascular omental cells in a canine model
Báo cáo khoa học: "Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury" potx
... we examined whether canine ASCs could survive and integrate into neural cells and the effectiveness of canine ASCs on the improvement of neurological function in canine SCI model Materials and ... Most dogs had mild vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site Vacuolar formations and cavitation acted as a physical barrier to ... administration of propofol (Ha Na Pharm, Korea) at mg/kg Anesthesia was maintained by 2% isoflurane (Ilisung, Korea) in oxygen The minimum alveolar concentration was about 1.5 A multiparameter anesthetic...
- 12
- 309
- 0
Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf
... IFN-g release and cell- mediated cytotoxicity after vaccination with mGC8 cells and GM-CSF T cells generated from TVDLN at day nine after vaccination were polyclonally activated and expanded as described ... antigen-presenting cells (APC) are recruited, activated and capable of activating tumor-specific T cells in the vaccine-draining lymph nodes [33,37] A future aim of our immunotherapeutic approaches is ... Cytotoxic markers and frequency predict functional capacity of natural killer cells infiltrating renal cell carcinoma Clin Cancer Res 2006, 12:718-725 Salem ML, Diaz-Montero CM, Al Khami AA, El Naggar...
- 14
- 454
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" pot
... dysplasia of both acetabula, and severe osteoarthritis and subluxation of both hip joints On physical examination, the patient was small in stature (4ft 2in, 65lbs) and had obvious craniofacial abnormalities ... caution in patients with sensitivities to avian proteins, feathers, and egg products It also carries a similar side-effect profile, including local inflammation, injection site pain and itching, anaphylaxis/anaphylactoid ... Syndrome and debilitating, painful bilateral hip dysplasias using intra-articular sodium hyaluronate injections This management option should be Salter et al Journal of Orthopaedic Surgery and Research...
- 5
- 462
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" ppt
... dysplasia of both acetabula, and severe osteoarthritis and subluxation of both hip joints On physical examination, the patient was small in stature (4ft 2in, 65lbs) and had obvious craniofacial abnormalities ... caution in patients with sensitivities to avian proteins, feathers, and egg products It also carries a similar side-effect profile, including local inflammation, injection site pain and itching, anaphylaxis/anaphylactoid ... Syndrome and debilitating, painful bilateral hip dysplasias using intra-articular sodium hyaluronate injections This management option should be Salter et al Journal of Orthopaedic Surgery and Research...
- 5
- 393
- 0
Báo cáo hóa học: " Influence of grazing and precipitation on ecosystem carbon cycling in a mixed-grass prairie" potx
... fixation in a semiarid grassland Journal of Geophysical Research 112:G03011 Harper, CW, JM Blair, PA Fay, AK Knapp, and JD Carlisle 2005 Increased rainfall variability and reduced rainfall amount ... 1996 Rangelands in a changing climate: Impacts, adaptations and mitigation In Climate change 1995 Impacts, adaptations and mitigation of climate change: Scientific-technical analyses, ed Watson ... Houghton, MI, USA 2Environment and Natural Resources Institute, University of Alaska Anchorage, Anchorage, AK, USA Biology Department, University of Alaska Anchorage, Anchorage, AK, USA Authors’ contributions...
- 15
- 384
- 0
báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc
... between-family and limited within-family variation of mt DNA markers in the offspring under study Within-sibship variation was attributable to paternal inheritance, lineage sorting or maybe to the rearrangement ... different haplotypes in the atp1 flanking regions (a4 1, a4 2, a4 4, a5 2, a4 5 and a5 4; figure 1a, Table 1) Additional faint bands were observed in nearly all RFLP patterns (94%) in at least one combination ... cox1 gene and internal primers were developed to sequence the atp1 gene (AtpA297F: TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding regions...
- 11
- 163
- 0
Báo cáo y học: "Prospective evaluation of serum biomarker levels and cartilage repair by autologous chondrocyte transplantation and subchondral drilling in a canine model" pps
... KW participated in operative anesthesia and preoperative and postoperative animal care JS and NP participated in pathological and radiological interpretation SL participated in statistical analysis ... (a) Repaired cartilage from the autologous chondrocyte transstaining plantation group (hematoxylin and eosin) demonstrates a cellular arrangement, (b) and glycosaminoglycan-containing extracellular ... transplantation; ALT, alanine aminotransferase; AST, aspartate aminotransferase; BUN, blood urea nitrogen; CI, confidence interval; Cr, creatinine; SD, subchondral drilling Serum cartilage marker evaluation...
- 9
- 373
- 0
Báo cáo y học: "Storage and allogeneic transplantation of peripheral nerve using a green tea polyphenol solution in a canine model'''' ppsx
... Surgery Anesthesia Animals were sedated with 0.2 mg/kg acepromazine given subcutaneously After intubation, general anesthesia was induced by inhalation with 5% isoflurane After confirming that the animals ... Tacrolimus, an update of its pharmacology and clinical efficacy in the management of organ transplantation Drug 1997, 54:925 12 Undre NA, Stevenson P, Schafer A: Pharmacokinetics of tacrolimus: clinically ... calculated The total number of myelinated axons in each specimen was estimated as b × a/ c The mean myelinated axon diameter (in μm) is expressed as the average value of the shortest diameter of...
- 8
- 400
- 0
Báo cáo y học: "Effect of magnesium sulfate administration on blood–brain barrier in a rat model of intraperitoneal sepsis: a randomized controlled experimental study" ppt
... leads to the formation of brain edema in septic rats Magnesium administration attenuated the increased BBB permeability and caused a reduction in brain edema formation in our rat model of intraperitoneal ... infusion of bacteria in a chronic porcine model Anesthesiology 2000, 93:793-804 18 van den Brink WA, Marmarou A, Avezaat CJ: Brain edema in experimental closed head injury in the rat Acta Neurochir ... change in the SG representing brain tissue edema formation was relatively minor Although the small change in SG that we obtained in the sepsis group reached statistical significance, indicating...
- 6
- 283
- 0
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis
... exocrine pancreas contains clusters of enzyme-producing cells called the pancreatic acinar cells Pancreatic acinar cells, along with pancreatic duct cells and other minor exocrinerelated cell ... GCTGCCCTTCCACATCTTCT-3’ 5’- CGCGATGCAGAACTACGAAA-3’ 5’- CAGCCTCAGCCGAAACTACA-3’ 223 282 156 2.2.9 Whole cell lysate preparation and Western blot analysis After treatment of pancreatic acinar cells, ... isolated pancreatic acinar cells are widely considered to be a valid model to investigate pathological changes in pancreatitis Caerulein treated pancreatic acinar cells is one of the best characterized...
- 190
- 432
- 0
Role of central nervous system ceramides and free radicals in a mouse model of orofacial pain
... complicated because of the region’s density of anatomical structures, rich innervations and high vascularity Orofacial pain is defined by the American Academy of Orofacial Pain (AAOP) as “pain conditions ... ceramide in orofacial pain induced by facial carrageenan injection ICV injection of inhibitors to acid sphingomyelinase (ASMase), neutral sphingomyelinase (NSMase), or serine palmitoyltransferase ... injection of an irritant substance into a joint or hind paw of animals The chronic neuropathic pain models usually involve surgical manipulation of a nerve Behavioral testing approaches can be classified...
- 178
- 352
- 0
Effects of serial passaging on west nile virus (sarafend) in a mouse model
... Saharan Africa and Madagascar (Scherret et al., 2001) Lineage I has been traditionally linked to higher pathogenicity and outbreaks in human populations while lineage II is often associated with ... regions of mutations iii Testing of passaged and unpassaged virus morbidity and mortality levels in suckling and adult mice iv Infecting primary mouse neural cells with passaged and unpassaged viruses ... humans and animals, with symptoms ranging from febrile illness to fatal encephalitis About 20 percent of infected patients display a range of symptoms including fever, headache, malaise, back pain,...
- 217
- 326
- 0
Báo cáo hóa học: " Differential sensitivity of melanoma cell lines with BRAFV600E mutation to the specific Raf inhibitor PLX4032" potx
... using Affymetrix GeneChip® Human Mapping 250K Nsp Array (Affymetrix, Santa Clara, CA) Cell proliferation and viability assays Melanoma cell lines were treated in triplicates with PLX4032 and parallel ... ribonuclease A from bovine pancreas (Sigma-Aldrich) Flow cytometry was performed on FACSCalibur or FACScan and data was analyzed using FlowJo BRAFV600E mutation analysis SNP array analysis DNA extracted ... UCLA, Los Angeles, CA, USA, 4Department of Pathology and Laboratory Medicine, UCLA, Los Angeles, CA, USA, 5The Broad Institute of MIT and Harvard, Cambridge, MA USA, 6Departments of Medical and...
- 11
- 448
- 0
Influence of fluid resuscitation on renal microvascular PO2 in a normotensive rat model of endotoxemia potx
... et al Figure Figure Creatinine clearance as an index the glomerular filtration rate Creatinine clearance as an index of of the glomerular filtration rate Creatinine clearance measured at baseline ... by an increased heart rate, a slight reduction in MAP, a marked decline in RBF, an increase in renal vascular resistance, and a reduction in the glomerular filtration rate resulting in anuria As ... collected at 10-minute intervals for analysis of urine volume and creatinine concentration Plasma samples for analysis of creatinine were obtained at the midpoint of each 10-minute urine collection...
- 13
- 179
- 0
Báo cáo y học: "The association of endothelial cell signaling, severity of illness, and organ dysfunction in sepsis" ppt
... therapy The aim of the present study was to assay a broad range of endothelial markers in a large sample of human patients at the time of emergency department (ED) presentation with the goal of ... activator (u-PA) mediate the conversion of plasminogen to plasmin Plasmin, in turn, proteolytically degrades fibrin Activated endothelial cells express increased levels of plasminogen activator inhibitor ... of VEGF are increased Elevated VEGF signaling, in turn, leads to increased vascular leak, leukocyte adhesion/trafficking, and clot formation Sepsis is also associated with increased circulating...
- 12
- 281
- 0
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
... ear veins and ketamine was infused (50 mg/h) for anesthesia Diazepam was administered as needed The HIFU ablation procedure complies with the guidance of the National Standard of China and was described ... the imaging probe was placed either against the skin or at a distance from the skin in water for pre-treatment imaging The integrated transducer was mounted in a degassed water reservoir with ... microscopic examination revealed further details such as presence of karyopyknosis and chromatin margination in some cells, intercellular space widening, apoptotic bodies with high electron-density and...
- 7
- 481
- 0
Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx
... categories are shown as means with ranges where appropriate Comparative data between characteristics are displayed, and data are summarized as tables as well as in text Results Patient characteristics ... awareness King Fahad National Guard Hospital is an 800-bed tertiary care hospital located in the central region of the Kingdom of Saudi Arabia (KSA), provides multilevel health care for National Guard ... mechanical ventilation It is probable that debilitating factors such as alcoholism or anemia are contributory Aspiration of sputum leading to aspiration pneumonia was a less common diagnosis in...
- 6
- 506
- 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
... pressure The sample containment, maintained at °C, was purged with dry air to minimize absorbance by water vapor A water-cooled globar was used as source of radiation, which was measured by a nitrogen-cooled ... molecular details of the reaction of caged oxygen and cytochrome bo3 The protein was reduced with the quasi-natural substrate analog duroquinol The samples reached a stable baseline after 2–4 h at ... HPBC in borate buffer The cuvette was sealed with another CaF2 plate, and placed into a metallic sample holder The following cuvette handling was carried out in the aerobic atmosphere The absorbance...
- 8
- 474
- 0
The Risk of Obstructive Lung Disease by Previous Pulmonary Tuberculosis in a Country with Intermediate Burden of Tuberculosis potx
... nodules with distinct margins, with or without calcification, within the upper lobes Based on CXR findings, we categorized the TB lesion of each subject as minimal, moderately advanced, or far-advanced, ... that the presence of minimal lesions was also an independent risk factor for airflow obstruction In these patients, airway fibrosis and inflammation may play important roles TB infection is associated ... and Respiratory Disease Association; 1969 15 Mohan A, Premanand R, Reddy LN, Rao MH, Sharma SK, Kamity R, Bollineni S Clinical presentation and predictors of outcome in patients with severe acute...
- 6
- 441
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25